Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

DIVERSITAS GENETIK VIRUS DENGUE DAN NYAMUK VEKTOR DI DAERAH ENDEMIK DEMAM BERDARAH DENGUE (DBD) DI KOTA PADANG DENGAN METODE POLYMERASE CHAIN REACTION.

Presentasi serupa


Presentasi berjudul: "DIVERSITAS GENETIK VIRUS DENGUE DAN NYAMUK VEKTOR DI DAERAH ENDEMIK DEMAM BERDARAH DENGUE (DBD) DI KOTA PADANG DENGAN METODE POLYMERASE CHAIN REACTION."— Transcript presentasi:

1 DIVERSITAS GENETIK VIRUS DENGUE DAN NYAMUK VEKTOR DI DAERAH ENDEMIK DEMAM BERDARAH DENGUE (DBD) DI KOTA PADANG DENGAN METODE POLYMERASE CHAIN REACTION (PCR) Oleh: Dra. Hasmiwati, M.Kes. Dr. Dahelmi, MS dr. Nurhayati, M.Biomed.

2 Pendahuluan DBD masalah kesehatan serius KLB tahun 1970–1990 terjadi 4–6 thn Sekarang  3-4 thn  1-2 thn Virus dengue ditularkan nyamuk: Aedes spp. Terjadinya diversitas genetik nyamuk  populasi nyamuk tinggi, prevalensi penyakit meningkat. Terjadinya diversitas genetik nyamuk vektor memungkinkan terjadi diversitas genetik serotype virus dengue yang ditularkannya Penularan virus dengue terjadi secara horizontal dan vertikal (transovarian). Apakah dengan terjadinya diversitas genetik nyamuk vektor juga terjadi diversitas serotype virus dengue?

3 .Deteksi virus dengue dengan RT- PCR.Virus Dengue adalah Virus RNA.Variasi genetik virus dengue terjadi antara serotype dan juga dalam serotype tergantung waktu dan daerah penyebaran..Beberapa peneliti yang telah mendeteksi virus dengue pada nyamuk :Chow et al (1998),Harris, et al (1998),Johnson et al (2005),Liotta et al (2005)..

4 Tujuan Penelitian Tahun I Mengoleksi dan mengidentifikasi nyamuk vektor DBD (telur,larva dan dewasa) Mengetahui serotype virus dengue dari nyamuk vektor dengan metoda RT-PCR Menganalisis diversitas genetik serotype virus dengue dibanding dengan isolat Genebank Tahun II Menganalisis diversitas genetik nyamuk vektor DBD dengan metoda RAPD-PCR Mengetahui perkembangan ke 4 serotype virus dengue pada nyamuk vektor.

5 Manfaat Penelitian 1.Informasi nyamuk vektor DBD 2.Serotype virus dengue 3.Diversitas genetik serotype virus dengue 4.Diversitas genetik nyamuk vektor

6 Metode Penelitian 1.Lokasi Penelitian Daerah endemik,sporadik dan potensial DBD di Kota Padang Sumbar. 2. Pelaksanaan Penelitian Tahun I a. Koleksi dan identifikasi nyamuk vektor b. Isolasi virus dengue dari nyamuk vektor c. Elektroforesis d. Amplifikasi RNA virus dengue: RT-PCR e. Elektroforesis f. Sequencing

7 Metode Penelitian Tahun II 1.Isolasi DNA nyamuk vektor 2.Amplifikasi DNA nyamuk: RAPD-PCR 3.Elektroforesis 4.Diversitas Genetik virus DEN pada Nyamuk  Menginokulasikan virus dengue ke 4 serotipenya pada nyamuk dewasa secara intrathorasik  Dipelihara 14 hari, diisolasi virus, di amplifikasi RT-PCR dan di sequensing serta dibandingkan dengan isolat Genbank.

8 Komposisi Reaksi 1 step RT-PCR KomponenVolume/Raksi Rnase free water 7,5 μl 5x Qiagen 1 step RT PCR buffer 10,0 μl d NTP Mix 2,0 μl 5x q solution 10,0 μl Primer DF 3,0 μl Primer DR1 3,0 μl Primer DR 2 1,5 μl Primer DR 3 1,5 μl Primer DR 4 1,5 μl Qiagen 1 step RT PCR enzym 2,0 μl RNA (Template) 8,0 μl T o t a l 50,0 μl

9 Program Reverse Transkriptase dan Amplifikasi : Reaksi Suhu (ºC ) Waktu (menit) Jumlah siklus Reverse Transcriptase (RT)5030 Initial PCR9515 Denaturation941 Annealing x Extension721 Final extension7210

10 Analisis Data 1. Serotype virus dengue: Dengan program Clustal X Pohon filogenetik: distance method, parsimony dan likehood method, menggunakan software Philip versi 3.5c PAUP*Ver.4.10b 2. Diversitas genetik serotype virus dengue: sama dgn 1 3. Diversitas genetik nyamuk vektor: Menggunakan program NTSYs-PC, Gambaran dendrogam: UPGMA

11 Hasil dan Pembahasan 1. Distribusi Kasus DBD Hasil Survei kasus DBD Jan s/d Mei 2009 di : RSU BMC : 89 kasus RS Yos Sudarso : 130 kasus RSUD :118 kasus tersebar di 11 kec. Di kota Padang

12 Jenis dan karakter sampel Jenis nyamukLokasiJumlah individu ♂♀Jumlah Aedes aegypti Belimbing* Aedes aegypti SD I B. Mulia* Aedes aegyptiGadut* Aedes albopictusGadut* Aedes aegyptiSD I B. Mulia** Aedes aegyptiGadut** Total Tabel 3. Jenis dan Jumlah sampel nyamuk berdasarkan lokasi penelitian

13 Hasil Isolasi Virus Dengue pada nyamuk Gambar 1.Elektroferoragram RNA Virus Dengue Lokasi Gadut 1. RNA virus dari serum RNA virus A. aegypti jantan 4. RNA virus A. aegypti jantan dan betina 5. RNA virus A. aegypti betina 6. RNA virus A. aegypti jantan 7. RNA virus A. aegypti jantan dan betina 8. RNA virus A. aegypti betina 9. -

14 Gambar 2 :Elektroferogram RNA Virus Dengue Lokasi SDI BM (Simp.Haru) 1. RNA virus A. aegypti jantan dan betina Gadut 2. RNA virus A. aegypti betina Sp. Haru 3. RNA virus A. aegypti jantan Sp. Haru 4. RNA virus A. aegypti betina Sp. Haru 5. RNA virus A. aegypti jantan dan betina Sp. haru 6. RNA virus A. albopictus jantan dan betina Gadut 7. RNA virus A. aegypti betina Belimbing 8. RNA virus A. aegypti jantan Belimbing

15 Amplifikasi RNA Virus Dengue Elektroferogram Virus Dengue dengan RT-PCR Lokasi Gadut. M. Marker 1. RNA virus dari serum 2. RNA virus A. aegypti betina 3. RNA virus A. aegypti jantan 4. RNA virus A. aegypti jantan & betina 5. RNA virus A. aegypti betina 6. RNA virus A. aegypti jantan 7. RNA virus A. aegypti jantan & betina

16 Elektoferogram Virus dengue Dengan RT-PCR lokasi SDI BM (Simp.Haru). M. Marker 1. Kontrol negatif 2. RNA virus A. aegypti jantan dan betina Gadut 3. RNA virus A. aegypti betina Sp. Haru 4. RNA virus A. aegypti jantan Sp. Haru 5. RNA virus A. aegypti betina Sp. Haru 6. RNA virus A. aegypti jantan dan betina Sp. haru 7. RNA virus A. albopictus jantan dan betina Gadut

17 Kesimpulan 1. Seluruh kecamatan kota Padang endemik DBD. 2. Ae.aegypti dan Ae.albopictus, vektor DBD di kota Padang 3. Serotype virus dengue yang dapat dideteksi pada kedua jenis nyamuk diduga serotype 2 (Den 2).

18 Saran 1. Deteksi Virus dengue pada nyamuk vektor perlu dilakukan secara terus menerus sepanjang tahun untuk mengantisipasi terjadi KLB DBD. 2. Variasi genetik serotype virus perlu diketahui untuk mempelajari patofisiologi DBD.

19 Rencana penelitian tahun II 1. Mengetahui Diversitas genetik nyamuk vektor. 2. Mengamati perkembangan virus Den 1, 2, 3 dan 4 pada nyamuk vektor.

20 TERIMA KASIH

21 Rencana Tahun II Dari hasil koleksi dan Identifikasi nyamuk vektor DBD di kota Padang ternyata telah didapatkan bahwa nyamuk yang berperan sebagai vektor DBD di kota Padang adalah nyamuk Ae. aegypti dan Ae. albopictus. Serta telah dilakukan deteksi virus dengue pada nyamuk ini dan didapatkan bahwa virus dengue yang terdeteksi adalah virus dengue serotype 2 yang didapatkan pada nyamuk Ae. Aegypti dan Ae.albopictus. Untuk mengetahui diversitas genetik virus,mengetahui kemampuan perkembangan virus dengue pada nyamuk vektor dan diversitas nyamuk vektor perlu dilakukan penelitian lanjutan tahun kedua. Karena dengan diketahui diversitas genetik nyamuk vektor dan diversitas virus pada nyamuk ini di harapkan sangat penting untuk membantu dalam pengendalian dan pengontrolan nyamuk vekor DBD serta meningkatkan kewaspadaan dini dalam menekan terjadinya kejadian luar biasa (KLB) DBD yang menimbulkan masalah serius dimasa yang akan datang serta bisa dipersiapkan untuk kandidat vaksin DBD.

22 Isolasi RNA Virus Isolasi Virus Dengue dgn Kit Isolasi RNA Viral Qiagen (QiAmp Viral RNA mini kit} 30 ekor nyamuk dimaserasi dlam 60 μl PBS. Digerus dengan pelet pestel Ditambah 560 µl buffer AVL yang telah dipanaskan 80ºC. Tambahkan 5,6 ul RNA carrier + buffer AVL. Vortex 15 detik.Inkubasi 10 menit pada suhu kamar. Sentifus singkat,Tambahkan 560 ul etanol absolut. Vortex 15 detik dan sentrifus singkat. Diambil 630 μl larutan,masukakan ketabung pengumpul. Sentrifuse,8.000 rpm 1 menit, ulangi sampai semua lisat habis. Buang tabung yang berisi lisat dan ganti dengan tabung baru tambahkan 500 µl buffer AW1, sentrifuse rpm selama 1 menit. Buang tabung yg berisi filtrat ganti tabung baru,tambahkan 500 μl buffer AW2,sentrifuse rpm selama 3 menit. Buang tabung yang berisi filtrat ganti dengan tabung baru.tambahkan 60 μl buffer AVE, inkubasi 1 menit pada suhu kamar. Sentifuse 8.000rpm 1 menit Simpan pada -20 ºC. untuk diamplifikasi.

23 Primer RT-PCR Primer yang digunakan adalah : DF: 5 TCA ATA TGC TGA AAC GCG CGA GAA ACC G 3 DR1: 5 CGT CTC AGT GAT CCG GGG G 3 DR2: 5 CGC CAC AAG GGC CAT GAA CAG 3 DR3: 5 TAA CAT CAT CAT GAG ACA GAG C 3 DR4 : 5 TGT TGT CTT AAA CAA GAG AGG TC 3

24 Elektroforesis -Hasil isolasi RNA dielektroforesis pada agarose 1.5 % dalam 1% BBE ( Borate Boric EDTA pH 7,5). - Hasil Amplifikasi dielektoforesis pada agarose 2% dalam 0,5 TBE (Tris Borate EDTA}. -Divisualisasi,uv transluminator,foto polaroid -Pita yang diharapkan 486 bp D1,119 bp D2,290 bp D3 dan 389 bp D4.

25 Sequensing Penentuan urutan nukleotida serotype virus yang didapat di lakukandi PT. Charoen Pokhan Indonesia.

26 Pohon Filogenetik Dengan program software berdasarkan metoda statistik: Distanced methode jarak evolusinya dihitung untuk semua pasangan taxa dan pohon filogenetik dibuat berdasarkan hubungan diantara nilai nilai jarak tersebut. Parsimoni methode didasarkan pada jumlah terkecil subsitusi nukleotida yang menjelaskan keseluruhan proses evolusi untuk membuat pohon filogenetik Likehood methode didasarkan pada perhitungan jumlah kemungkinan pola variasi site yang dihasilkan oleh proses subsitusi dan frekwensi basa yang diamati.

27 Metode Thn II Isolasi DNA nyamuk(Hoelzel,1994) 100ul buffer CTAB 10x Dipanaskan pada waterbath 10 menit 60 C Tambahkan 1 ekor nyamuk,gerus Tambah 5 ul proteinase K dan 1ul 2mercaptoethanol Di vortek dan diinkubasi pada waterbath,2 jam,60 C Tambahkan 200 ul TE(50mM Tris/10mM,ph 8) dan200 ul phenol dan 200 ul kloroform: isoamil;alkohol(24:1) Sentrifus rpm,10 menit Supernatan pindah ke tbg baru tambah 200 ul kloroform: isoamil alkohol (24:1) Sentrifuse rpm, 10 menit Supernatan diambil tambah 200ul isopropanol Presipitasi dalam freezeer shu -20oC selama 1 malam Disentrifus rpm 10 menit,pellet diambil tambah 200 ul TE(50 mM Tris/10 mMEDTA,ph 8) tambah 20 ul ammonium asetat dan 500 ul alkohol absolut. Dipresipitasi pada suhu -70oC 1 jam Sentifus rpm,10 menit Larutan dibuang pellet ditambah 500 ulethanol 70% dingin Disentrifus rpm,5 menit Pelet dikering kan dan dilarutkan dengan 50 ul TE (Siap diamplifikasi)

28 Reaksi RAPD-PCR (William et.al.,1990) -2,5 ul buffer PCR -2,5 ul Mgcl2 25 mM -0,2 ul d NTP (dATP,dCTP,dGTP dan dTTP) -0,2 ul Taq polymerase -3-5 ul DNA -2,0 ul primer - untuk total 25 ul tambah mineral oil - kontrol negatif tanpa DNA -semua komponen dalam aliqout

29 Siklus PCR yang digunakan: -Denaturasi awal 94oC 4 menit 1x -Denaturasi 94 o C, 1 menit -Annealing 35 o C,1 menit -polimerisasi 72 o C,10 menit -sampel disimpan 4 o C,1 malam Primer yang dipakai: OPE 17 :5' CTACTGCCGT 3' OPF 4 :5' GGTGATCAGG 3' OPF 2 :5' GAGGATCCCT 3' COI : 5' TTGATTTTTTGGTCATCCAGAAGT 3'

30 Elektroforesis - Hasil amplifikasi dipisahkan dengan gel elektroforesis 1,2 % pada larutan TBE 1x (Sambrook et al., 1989) -Divisualisasi, uv transluminator,foto polaroid -Pita DNA hasil amplifikasi diskor 1 dan 0 dianalisis dengan NTSYs-PC - Polimorfisme : pita DNA yang tdk selalu hadir pada semua sampel monomorfisme:pita DNA yg selalu hadir pada semua sampel

31 Inokulasi virus pada nyamuk Teknik Inokulasi, jarum dan alat suntik yang dipergunakan adalah menurut cara Rosen dan Gubler (1974). Serum yang akan diinokulasikan diencerkan dalam garam dapar fosfat pH 7,4 yang mengandung 0,5% gelatin dan 5% serum anak sapi yang dipanaskan selama 30 menit pada suhu 56 oC. Nyamuk Aedes jantan dan betina didapat dari lapangan dengan pengoleksian telur (Ovitrap) setelah itu dipelihara di laboratorium sampai dewasa dengan pemberian makanan buatan. Serum yang mengandung Virus dengue disuntikan pada nyamuk yang telah dibius dengan menggunakan tabung kapiler yang ujungnya runcing (diruncingkan diatas nyala api). Nyamuk yang telah diinokulasi dipelihara dilaboratorium selama 10 – 14 hari hari dengan memberi makan nyamuk dengan larutan gula 10 %.

32 Hasmiwati : Ketua peneliti - Survey,koleksi sampel,identifikasi nyamuk vektor, isolasi RNA/DNA,amplifikasi,mmengolah data,membuat laporan. Djong Hon Tjong : anggota peneliti - isolasi RNA/DNA, amplifikasi,analisis data Dahelmi : anggota peneliti - Koleksi sampel,identifikasi nyamuk vektor,membuat laporan Nurhayati : anggota peneliti -koleksi sampel, identifikasi nyamuk,analisa data


Download ppt "DIVERSITAS GENETIK VIRUS DENGUE DAN NYAMUK VEKTOR DI DAERAH ENDEMIK DEMAM BERDARAH DENGUE (DBD) DI KOTA PADANG DENGAN METODE POLYMERASE CHAIN REACTION."

Presentasi serupa


Iklan oleh Google