Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

DNA Fingerpriunt Farmasi Forensik Prof.Drh.Darmono,M.Sc Dra.Mayagustina Andarini,M.Sc.

Presentasi serupa

Presentasi berjudul: "DNA Fingerpriunt Farmasi Forensik Prof.Drh.Darmono,M.Sc Dra.Mayagustina Andarini,M.Sc."— Transcript presentasi:

1 DNA Fingerpriunt Farmasi Forensik Prof.Drh.Darmono,M.Sc Dra.Mayagustina Andarini,M.Sc

2 DNA FINGERPRINT -Sidik jari (1930)-----  Sidik DNA (1989) -- Sidik jari dapat diubah dengan di operasi -Sidik DNA:- Ada pada semua jaringan -- Tidak dapat diubah Struktur DNA: 1.Struktur molekul: C (cytosin) G (guanin) A (adenin) T (thymin) 2. Bangunan dasar nukleotida: - gula/sugar - desoksiribosa - kelompok phosphat - 4 nitrogen dasar berpasangan: A-T;C-G;G-C;T-A;

3 Determinasi @ Segmen DNA dideterminasi dari pasangan gula phosphat @ DNA membedakan : - Karakter - Organisme - Individu

4 Nucleotida (asam amino)

5 Chromosome


7 Kromosom Diagram of a replicated and condensed metaphase eukaryotic chromosome. (1) Chromatid – one of the two identical parts of the chromosome after S phase. (2) Centromere – the point where the two chromatids touch, and where the microtubules attach. (3) Short arm. (4) Long arm.metaphase ChromatidS phase Centromere 3 2 4 1

8 KROMOSOM An image of the 46 chromosomes, making up the diploid genome of human male.

9 Analisis DNA 1.Isolasi DNA: darah, rambut, kulit, sperma dsb 2.Memotong mengukur dan mensortir (restriksi): dengan enzim restriksi asal bakteri: mis Eco RI  pada sequen GAATTC 3.- Elektroforesis gel - Transfer DNA ke nylon 4. Probing: -dengan radioaktif-  DNA.FP - Pewarna prob  DNA.FP 5. DNA. FP dengan pewarna prob lagi

10 Sidik DNA Setelah proses elektroporesis, kemudian diwarnai: Dengan methylen blue untuk pewarnaan gel Konvensional Pewarnaan khusus untuk peningkatan penampilan dan memudahkan pembacaan, dapat diwarnai : Dengan: - Carolina blue, atau - Quikviem DNA Kedua jenis pewarnaan ini dapat mengurangi back ground dan meningkatkan sensitiviti

11 POLYMERASE CHAIN REACTION (PCR) Reaksi penggandaan DNA: Diperlukan:- DNA original - dua molekul primer nukleotida utuh - larutan buffer - Taq DNA polimerases (enzim): Fungsi/kegunaanya:- Melipatgandakan DNA dengan cara mengkopi(copy) - Diagnosis untuk mengkonformasi DNA

12 PCR The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of the DNA. Primers (short DNA fragments) containing sequences complementary to the target region along with a DNA polymerase (after which the method is named) are key components to enable selective and repeated amplification. As PCR progresses, the DNA generated is itself used as a template for replication, setting in motion a chain reaction in which the DNA template is exponentially amplified. PCR can be extensively modified to perform a wide array of genetic manipulations.technique molecular biologyamplifyDNAthermal cyclingDNA meltingenzymaticreplicationPrimersDNA polymerasechain reaction exponentiallygenetic manipulations

13 Prosedure PCR Initialization step: This step consists of heating the reaction to a temperature of 94–96 °C (or 98 °C if extremely thermostable polymerases are used), which is held for 1–9 minutes. It is only required for DNA polymerases that require heat activation by hot-start PCR. [9]hot-start PCR [9] Denaturation step: This step is the first regular cycling event and consists of heating the reaction to 94–98 °C for 20–30 seconds. It causes DNA melting of the DNA template by disrupting the hydrogen bonds between complementary bases, yielding single strands of DNA.Denaturation stepDNA melting Annealing step: The reaction temperature is lowered to 50–65 °C for 20–40 seconds allowing annealing of the primers to the single-stranded DNA template. Typically the annealing temperature is about 3-5 degrees Celsius below the Tm of the primers used. Stable DNA-DNA hydrogen bonds are only formed when the primer sequence very closely matches the template sequence. The polymerase binds to the primer-template hybrid and begins DNA synthesis.Annealing step Extension/elongation step: The temperature at this step depends on the DNA polymerase used; Taq polymerase has its optimum activity temperature at 75–80 °C, [10][11] and commonly a temperature of 72 °C is used with this enzyme. At this step the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTPs that are complementary to the template in 5' to 3' direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl group at the end of the nascent (extending) DNA strand. The extension time depends both on the DNA polymerase used and on the length of the DNA fragment to be amplified. As a rule-of-thumb, at its optimum temperature, the DNA polymerase will polymerize a thousand bases per minute. Under optimum conditions, i.e., if there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment.Taq polymeraseactivity [10][11]phosphate grouphydroxyl group Final elongation: This single step is occasionally performed at a temperature of 70–74 °C for 5–15 minutes after the last PCR cycle to ensure that any remaining single-stranded DNA is fully extended. Final hold: This step at 4–15 °C for an indefinite time may be employed for short-term storage of the reaction

14 Proses PCR Denaturasiannealing primerReplikasi DNA

15 Denaturasi (suhu 94-96 o C) Dobel helix strand dipisah

16 Annealing Primer (suhu 50-65 o C) annealing/primer melekat pada masing-masing strand

17 Replikasi DNA (suhu 72 o C) masing-masing strand digandakan

18 Aplikasi DNA FP 1.Mendiagnosis Kelainan keturunan (genetik) - pada janin yang belum dilahirkan - Bayi yang baru dilahirkan 2.Penelitian mengenai kelainan genetik Normal  bandingkan  --Kelainan 3.Bukti biologik: untuk laboratorium forensik

19 Penyakit Genetik Gen makhluk hidup Ling- kungan

20 Klasifikasi penyakit genetik Penyakit Genetik Autosomal dominan *Achondro- plasia *Huntington-disease *Marfan – disease Autosomal resesif *Cystic – fibrosis *Sickle cel – anemia *Spinal- muscular atrophy X-Y-link X-link Dominant: *Aicardi *Klinefelter *Hipo- phospatemia X-link Resesif: *Hemophilia *Buta warna *Muscular destrofi Y-link: *Infertility pria Mitokondria *Leber hereditary optic neurophaty Multi-factorial *Autisme *Hipertensi *Cancer *Mental –dis. dsb

21 Achondroplasia

22 ENZIM UNTUK RESTRIKSI EnzimOrganismesequen yang dikenal ------------------------------------------------------------------------------------------------------------------------- EcoRIEscherichia coliGAATTC BamHIBacillus amyloliquefaciensGGATCC Bgl/IIbacillus globigiiAGATCT PvuIIproteus vulgarisCGATCG PvuIIIProteus vulgarisCAGCTG HindIIIhaemophilus influenzaeRdAAGCTT HinfIHaemophilus influenzaeRfGANTC Sau3AStaphylococcus aureusGATC AluIArthrobacter luteusAGCT TaqIThermus aquatusTCGA HaeIIIhaemophilus aegyptiusGGCC NotINocardia otitidis-caviarumGCGGCCGC

23 Mutasi DNA

24 Kelainan keturunan

25 Kasus perselingkuhan (hal. 51)

26 Kasus perkosaan (hal 52)

27 Kasus perkosaan (hal. 53)

28 MINI-SATELIT Variable Number Tandem Repeat (VNTR) -Pada kromosom manusia ada sequens pendek yang diulang -Ulangan : dari 1-30 ulangan -Dapat dipotong pada variasi jumlah tandem repeat: dengan cara - hibridisasi dan probe spesifik “TAAGGGCCATAAGGGCCATAAGGGCCA”


30 Ayah Ibu Ayah---------------Anak------------------ Ibu

31 VNTR Single locus: -memperlihatkan locus-tunggal probe VNTR sangat mudah diinterpretasikan untuk setiap individu dengan band yang tidak lebih dari dua -Digunakan di Amerika untuk penyidikan forensik dan jejak keturunan Multi locus: -Memperlihatkan locus-multi probe VNTR, banyak informasi yang dapat dibaca secara simultan dengan band antara 10-30 Tetapi agak susah interpretasinya -Digunakan di Eropa untuk penyidikan forensik dan jejak keturunan

Download ppt "DNA Fingerpriunt Farmasi Forensik Prof.Drh.Darmono,M.Sc Dra.Mayagustina Andarini,M.Sc."

Presentasi serupa

Iklan oleh Google