Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

Genetika molekuler Prof. Drs. Sutarno, MSc., PhD..

Presentasi serupa


Presentasi berjudul: "Genetika molekuler Prof. Drs. Sutarno, MSc., PhD.."— Transcript presentasi:

1 Genetika molekuler Prof. Drs. Sutarno, MSc., PhD.

2 Genetics

3 Molecular genetics? Merupakan cabang biologi yang mempelajari struktur dan fungsi gen pada aras molekuler, serta bagaimana gen diturunkan dari generasi ke generasi. Merupakan cabang biologi yang mempelajari struktur dan fungsi gen pada aras molekuler, serta bagaimana gen diturunkan dari generasi ke generasi. Memanfaatkan metode-metode genetika dan biologi molekuler. Memanfaatkan metode-metode genetika dan biologi molekuler. Area penting dalam genetika molekuler adalah penggunaan informasi molekuler untuk menentukan pola penurunan, dan juga dalam pengklassifikasian (molecular systematics). Area penting dalam genetika molekuler adalah penggunaan informasi molekuler untuk menentukan pola penurunan, dan juga dalam pengklassifikasian (molecular systematics).molecular systematicsmolecular systematics Melalui penggunaan metode-metode genetika dan biologi molekuler, genetika molekuler berusaha menyingkap alasan-alasan bagaimana sifat atau karakter dimunculkan serta bagaimana dan mengapa beberapa diantaranya mengalami mutasi. Melalui penggunaan metode-metode genetika dan biologi molekuler, genetika molekuler berusaha menyingkap alasan-alasan bagaimana sifat atau karakter dimunculkan serta bagaimana dan mengapa beberapa diantaranya mengalami mutasi.

4 Cells, genome, gene and DNA Almost all cells of a living organism contain an identical set of codes describing the genes and their regulation Almost all cells of a living organism contain an identical set of codes describing the genes and their regulation Cells from the different parts of an organism have the same DNA Cells from the different parts of an organism have the same DNA Distinction: The portion of the DNA that is transcribed and translated into protein Distinction: The portion of the DNA that is transcribed and translated into protein Genome: entire complement of DNA molecules of each organism Genome: entire complement of DNA molecules of each organism Overall function of genome: Control the generation of molecules (mostly proteins) that will Overall function of genome: Control the generation of molecules (mostly proteins) that will Regulate the metabolism of a cell and its response to the environment, and Regulate the metabolism of a cell and its response to the environment, and Provide structural integrity. Provide structural integrity.

5

6

7 Cell, Genome,chromosome and gene

8 DNA can be thought of as the “blueprint” for an organism can be thought of as the “blueprint” for an organism composed of small molecules called nucleotides composed of small molecules called nucleotides four different nucleotides distinguished by the four bases : adenine (A), cytosine (C), guanine (G) and thymine (T) four different nucleotides distinguished by the four bases : adenine (A), cytosine (C), guanine (G) and thymine (T) is a polymer : large molecule consisting of similar units (nucleotides in this case) is a polymer : large molecule consisting of similar units (nucleotides in this case) DNA is digital information DNA is digital information a single strand of DNA can be thought of as a string composed of the four letters: A, C, G, T a single strand of DNA can be thought of as a string composed of the four letters: A, C, G, T Ctgctggaccgggtgctaggaccctgactgcc Ctgctggaccgggtgctaggaccctgactgcc cggggccgggggtgcggggcccgctgag… cggggccgggggtgcggggcccgctgag…

9 The Double Helix DNA molecules usually consist of two strands arranged in the famous double helix

10 Watson-Crick Base Pairs A bonds to T A bonds to T C bonds to G C bonds to G

11 Chromosomes DNA is packaged into individual chromosomes (along with proteins) DNA is packaged into individual chromosomes (along with proteins) prokaryotes (single-celled organisms lacking nuclei) have a single circular chromosome prokaryotes (single-celled organisms lacking nuclei) have a single circular chromosome eukaryotes (organisms with nuclei) have a species-specific number of linear chromosomes eukaryotes (organisms with nuclei) have a species-specific number of linear chromosomes DNA + associated chromosomal proteins = chromatin DNA + associated chromosomal proteins = chromatin

12 Kromosom Merupakan struktur makromolekul besar yang memuat DNA yang membawa informasi genetik dalam sel. DNA terbalut dalam satu atau lebih kromosom. Merupakan struktur makromolekul besar yang memuat DNA yang membawa informasi genetik dalam sel. DNA terbalut dalam satu atau lebih kromosom.makromolekulDNAinformasi genetikselmakromolekulDNAinformasi genetiksel Sebuah kromosom (dalam bahasa Yunani chroma = warna dan soma = badan) adalah seberkas DNA yang sangat panjang dan berkelanjutan, Sebuah kromosom (dalam bahasa Yunani chroma = warna dan soma = badan) adalah seberkas DNA yang sangat panjang dan berkelanjutan,bahasa Yunanibahasa Yunani Dalam kromosom eukariota, DNA yang tidak terkondensasi berada dalam struktur tertentu dalam nukleus, dimana ia membungkus histon (protein struktural). Selama mitosis (pembelahan sel), kromosom terkondensasi dan disebut kromosom metafase. Hal ini menyebabkan masing-masing kromosom dapat diamati melalui mikroskop. Dalam kromosom eukariota, DNA yang tidak terkondensasi berada dalam struktur tertentu dalam nukleus, dimana ia membungkus histon (protein struktural). Selama mitosis (pembelahan sel), kromosom terkondensasi dan disebut kromosom metafase. Hal ini menyebabkan masing-masing kromosom dapat diamati melalui mikroskop.eukariotanukleus histonproteinmitosismetafase mikroskopeukariotanukleus histonproteinmitosismetafase mikroskop Setiap kromosom memiliki dua lengan, yang pendek disebut lengan p (dari bahasa Perancis petit yang berarti kecil) dan lengan yang panjang lengan q (q mengikuti p dalam alfabet). Setiap kromosom memiliki dua lengan, yang pendek disebut lengan p (dari bahasa Perancis petit yang berarti kecil) dan lengan yang panjang lengan q (q mengikuti p dalam alfabet).bahasa Perancisbahasa Perancis Prokariota tidak memiliki histon dan nukleus. Prokariota tidak memiliki histon dan nukleus. Prokariota

13

14 Genomes the term genome refers to the complete complement of DNA for a given species the term genome refers to the complete complement of DNA for a given species the human genome consists of 46 chromosomes. the human genome consists of 46 chromosomes. every cell (except sex cells and mature red blood cells) contains the complete genome of an organism every cell (except sex cells and mature red blood cells) contains the complete genome of an organism

15 Proteins proteins are molecules composed of one or more polypeptides proteins are molecules composed of one or more polypeptides a polypeptide is a polymer composed of amino acids a polypeptide is a polymer composed of amino acids cells build their proteins from 20 different amino acids cells build their proteins from 20 different amino acids a polypeptide can be thought of as a string a polypeptide can be thought of as a string composed from a 20-character alphabet composed from a 20-character alphabet

16 Genes genes are the basic units of heredity genes are the basic units of heredity a gene is a sequence of bases that carries the information required for constructing a particular protein (polypeptide really) a gene is a sequence of bases that carries the information required for constructing a particular protein (polypeptide really) such a gene is said to encode a protein such a gene is said to encode a protein the human genome comprises ~ 35,000 genes the human genome comprises ~ 35,000 genes Those genes encode > 100,000 polypeptides Those genes encode > 100,000 polypeptides

17 Structure of eukaryotic gene

18 Gene Density Gene Density Gene Density not all of the DNA in a genome encodes protein: not all of the DNA in a genome encodes protein: microbes 90% coding gene/kb microbes 90% coding gene/kb human 3% coding gene human 3% coding gene About 1/2 of non-coding DNA in humans is conserved About 1/2 of non-coding DNA in humans is conserved

19 The Central Dogma

20 RNA RNA is like DNA except: RNA is like DNA except: backbone is a little different backbone is a little different usually single stranded usually single stranded the base uracil (U) is used in place of thymine (T) the base uracil (U) is used in place of thymine (T) a strand of RNA can be thought of as a string composed of the four letters: A, C, G, U a strand of RNA can be thought of as a string composed of the four letters: A, C, G, U

21 Transcription

22 Transcription RNA polymerase is the enzyme that builds an RNA strand from a gene RNA polymerase is the enzyme that builds an RNA strand from a gene RNA that is transcribed from a gene is called messenger RNA (mRNA) RNA that is transcribed from a gene is called messenger RNA (mRNA)

23 Translation ribosomes are the machines that synthesize proteins from mRNA ribosomes are the machines that synthesize proteins from mRNA the grouping of codons is called the reading frame the grouping of codons is called the reading frame translation begins with the start codon translation begins with the start codon translation ends with the stop codon translation ends with the stop codon

24 Codons and Reading Frames

25 Protein Synthesis in Eukaryotes vs. Prokaryotes

26 Genes include both coding regions as well as control regions


Download ppt "Genetika molekuler Prof. Drs. Sutarno, MSc., PhD.."

Presentasi serupa


Iklan oleh Google