Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

METODE TRANSFORMASI GEN SUCROSE PHOSPHATE SYNTHASE (SoSPS1) TEBU UNTUK MENINGKATKAN SINTESA SUKROSA PADA DAUN TEMBAKAU LITA RASIMA RATNA KARTIKAWATI APRINO.

Presentasi serupa


Presentasi berjudul: "METODE TRANSFORMASI GEN SUCROSE PHOSPHATE SYNTHASE (SoSPS1) TEBU UNTUK MENINGKATKAN SINTESA SUKROSA PADA DAUN TEMBAKAU LITA RASIMA RATNA KARTIKAWATI APRINO."— Transcript presentasi:

1 METODE TRANSFORMASI GEN SUCROSE PHOSPHATE SYNTHASE (SoSPS1) TEBU UNTUK MENINGKATKAN SINTESA SUKROSA PADA DAUN TEMBAKAU LITA RASIMA RATNA KARTIKAWATI APRINO CAHYO ABADI

2 Pendahuluan Biosintesis sukrosa dipengaruhi kinerja enzim Sucrose phosphate synthase (SPS) Tanaman tembakau ditransformasi dengan cDNA SPS tebu dengan pKYS pada Agrobacterium Tujuan : untuk mengetahui aktivitas SPS kandungan sukrosa daun pada tembakau transgenik

3 Apa itu? SPS adalah salah satu enzim yang berperan dalam sintesis sukrosa selain SS dan Inv Transformasi adalah perubahan Agrobacterium adalah bakteri yang mengandung plasmid pKYS yang digunakan untuk mensisipi cDNA SPS tebu CaMV adalah sekuen RNA sebagai primer Sukrosa adalah produk akhir dalam proses fotosintesis yang dapat digunakan untuk pertumbuhan dan perkembangan

4 Konstruksi gen SPS pada pBI 121 tanpa gen GUS dan posisi macam primer (P 1,2,3,4 ) yang digunakan dalam analisis PCR Nos- Pro NPT II (Kan R) NOS- Ter Pro CaMV SPS tebu NOS- Ter 700 kb 600 kb P1P1 P2P2 P4P4 P3P3

5 Tranformasi DNA pKYS pada Agrobacterium Menggunakan Agrobacterium tumefaciens strain LB4404 Agrobacterium dikonstruk dengan metode An et. al. (1985) Agrobacterium transforman dianalsis untuk mengetahui keberadaan pKYS dengan PCR dari sekuen gen Sosps 1 sbb: –P 1 :5’GATTCTGATACAGTTGGCCA3’(forward primer) –P 2 :5’TCCTGCCTTGTGTGCTCGTGAT3’(reverse primer) Hasil analisis PCR ternyata Agrobacterium transforman telah membawa gen SPS tebu.

6 Transformasi Tembakau dengan Agrobacterium transforman Daun tembakau steril diinfeksi dgn Agrobacterium transfoman pada media MS cair Kemudian diinkubasi selanjutnya di ko- kultivasi dan kemudian dicuci dengan media MS yang mengandung cefotaxime untuk mematikan Agrobacterium. Setelah itu diregenerasi pada media MS padat yang mengandung kanamisin dan cefotaxime

7 Analisis keberadaan SPS pada daun tembakau dengan PCR Analisis PCR untuk mengetahui keberadaan gen SPS tebu pada daun tembakau dengan cara: –Predenaturation, Denaturation, Annelaing dan Extension Primer yang digunakana didesain berdasarkan sekuen CaMV untuk forward primer dan sekuen SPS untuk reverse primer. –P 3 :5’GGACCTAACAGAACTCGCCG3’(forard primer) –P 4 :5’CACCTCCTCGACGAAGTAGTG3’(reverse primer) Berdasarkan primer tsb diperoleh 3 galur yang mengandung SPS tebu. Hal ini menunjukkan gen SPS telah dapat terintegrasi pada kromosom tembakau melalui Agrobacterium.

8 Analsis protein dan aktivitas SPS pada tembakau transgenik Kemampuan mensintesis sukrosa ditentukan oleh jumlah protein dan aktivitas enzim SPS Besar kecilnya jumlah protein ditentukan ekspresi dan juga jumlah kopi gen dalam tanaman. Melalui Western blot maka menggunakan antibodi SPS1 tebu didapatkan beberapa galur tembakau dapat mengekspresikan gen SPS tebu

9 Korelasi aktivitas SPS dan kandungan sukrosa Untuk membandingkan digunakan tembakau wild type sebagai kontrol. Ternyata galur tembakau transgenik yang dapat mengekspresikan gen SPS tebu terjadi peningkatan kandungan sukrose Tapi juga terdapat yang tidak berbeda nyata dengan wild type hal ini karena diduga terjadi peningkatan aktivitas enzim yang menghidrolisis sukrose pada tembakau transgenik tsb.

10 Kegunaan selanjutnya apa sih?? Untuk mengetahui ketepatan konstruksi cDNA SPS pada pKYS yang dibuat dan pengaruhnya terhadap aktivitas SPS dan kandungan sukrosa daun Keberhasilan penelitan in selanjutnya digunakan untuk pengembangan tanaman tebu transgenik yang mempunyai kemampuan sintesis sukrosa lebih besar

11 Berdasarkan Penelitan yang dilakukan: Miswar,Bambang Sugiharto, Joedoro Soedarsono dan Sukarji Moeljopawiro

12


Download ppt "METODE TRANSFORMASI GEN SUCROSE PHOSPHATE SYNTHASE (SoSPS1) TEBU UNTUK MENINGKATKAN SINTESA SUKROSA PADA DAUN TEMBAKAU LITA RASIMA RATNA KARTIKAWATI APRINO."

Presentasi serupa


Iklan oleh Google