Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

DNA FINGERPRINT -Sidik jari (1930)-----  Sidik DNA (1989) -- Sidik jari dapat diubah dengan di operasi -Sidik DNA:- Ada pada semua jaringan -- Tidak dapat.

Presentasi serupa

Presentasi berjudul: "DNA FINGERPRINT -Sidik jari (1930)-----  Sidik DNA (1989) -- Sidik jari dapat diubah dengan di operasi -Sidik DNA:- Ada pada semua jaringan -- Tidak dapat."— Transcript presentasi:

1 DNA FINGERPRINT -Sidik jari (1930)-----  Sidik DNA (1989) -- Sidik jari dapat diubah dengan di operasi -Sidik DNA:- Ada pada semua jaringan -- Tidak dapat diubah Struktur DNA: 1.Struktur molekul: C (cytosin) G (guanin) A (adenin) T (thymin) 2. Bangunan dasar nukleotida: - gula/sugar - desoksiribosa - kelompok phosphat - 4 nitrogen dasar berpasangan: A-T;C-G;G-C;T-A;

2 Determinasi @ Segmen DNA dideterminasi dari pasangan gula phosphat @ DNA membedakan : - Karakter - Organisme - Individu

3 Nucleotida (asam amino)

4 Chromosome


6 Kromosom Lengan pendek (p) Lengan panjang (q)

7 Analisis DNA 1.Isolasi DNA: darah, rambut, kulit, sperma dsb 2.Memotong mengukur dan mensortir (restriksi): dengan enzim restriksi asal bakteri: mis Eco RI  pada sequen GAATTC 3.- Elektroforesis gel - Transfer DNA ke nylon 4. Probing: -dengan radioaktif-  DNA.FP - Pewarna prob  DNA.FP 5. DNA. FP dengan pewarna prob lagi

8 Sidik DNA Setelah proses elektroporesis, kemudian Diwarnai: Dengan methylen blue untuk pewarnaan gel Konvensional Pewarnaan khusus untuk peningkatan penampilan Dan memudahkan pembacaan, dapat diwarnai : Dengan: - Carolina blue, atau - Quikviem DNA Kedua jenis pewarnaan ini dapat mengurangi Back ground dan meningkatkan sensitiviti

9 POLYMERASE CHAIN REACTION (PCR) Reaksi penggandaan DNA: Diperlukan:- DNA original - dua molekul primer nukleotida utuh - larutan buffer - Taq DNA polimerases (enzim): Fungsi/kegunaanya:- Melipatgandakan DNA dengan cara mengkopi(copy) - Diagnosis untuk mengkonformasi DNA

10 Proses PCR Denaturasiannealing primerReplikasi DNA

11 Denaturasi (suhu 94-96 o C) Dobel helix strand dipisah

12 Annealing Primer (suhu 50-65 o C) annealing/primer melekat pada masing-masing strand

13 Replikasi DNA (suhu 72 o C) masing-masing strand digandakan

14 Aplikasi DNA FP 1.Mendiagnosis Kelainan keturunan (genetik) - pada janin yang belum dilahirkan - Bayi yang baru dilahirkan 2.Penelitian mengenai kelainan genetik Normal  bandingkan  --Kelainan 3.Bukti biologik: untuk laboratorium forensik

15 Penyakit Genetik Gen makhluk hidup Ling- kungan

16 Klasifikasi penyakit genetik Penyakit Genetik Autosomal dominan *Achondro- plasia *Huntington-disease *Marfan – disease Autosomal resesif *Cystic – fibrosis *Sickle cel – anemia *Spinal- muscular atrophy X-Y-link X-link Dominant: *Aicardi *Klinefelter *Hipo- phospatemia X-link Resesif: *Hemophilia *Buta warna *Muscular destrofi Y-link: *Infertility pria Mitokondria *Leber hereditary optic neurophaty Multi-factorial *Autisme *Hipertensi *Cancer *Mental –dis. dsb

17 Achondroplasia

18 ENZIM UNTUK RESTRIKSI EnzimOrganismesequen yang dikenal ------------------------------------------------------------------------------------------------------------------------- EcoRIEscherichia coliGAATTC BamHIBacillus amyloliquefaciensGGATCC Bgl/IIbacillus globigiiAGATCT PvuIIproteus vulgarisCGATCG PvuIIIProteus vulgarisCAGCTG HindIIIhaemophilus influenzaeRdAAGCTT HinfIHaemophilus influenzaeRfGANTC Sau3AStaphylococcus aureusGATC AluIArthrobacter luteusAGCT TaqIThermus aquatusTCGA HaeIIIhaemophilus aegyptiusGGCC NotINocardia otitidis-caviarumGCGGCCGC

19 Mutasi DNA

20 Kelainan keturunan

21 Kasus perselingkuhan (hal. 51)

22 Kasus perkosaan (hal 52)

23 Kasus perkosaan (hal. 53)

24 MINI-SATELIT Variable Number Tandem Repeat (VNTR) -Pada kromosom manusia ada sequens pendek yang diulang -Ulangan : dari 1-30 ulangan -Dapat dipotong pada variasi jumlah tandem repeat: dengan cara - hibridisasi dan probe spesifik “TAAGGGCCATAAGGGCCATAAGGGCCA”


26 Ayah Ibu Ayah---------------Anak------------------ Ibu

27 VNTR Single locus: -memperlihatkan locus-tunggal probe VNTR sangat mudah diinterpretasikan untuk setiap individu dengan band yang tidak lebih dari dua -Digunakan di Amerika untuk penyidikan forensik dan jejak keturunan Multi locus: -Memperlihatkan locus-multi probe VNTR, banyak informasi yang dapat dibaca secara simultan dengan band antara 10-30 Tetapi agak susah interpretasinya -Digunakan di Eropa untuk penyidikan forensik dan jejak keturunan

Download ppt "DNA FINGERPRINT -Sidik jari (1930)-----  Sidik DNA (1989) -- Sidik jari dapat diubah dengan di operasi -Sidik DNA:- Ada pada semua jaringan -- Tidak dapat."

Presentasi serupa

Iklan oleh Google