Farmasi Forensik Prof.Drh.Darmono,M.Sc Dra.Mayagustina Andarini,M.Sc DNA Fingerpriunt Farmasi Forensik Prof.Drh.Darmono,M.Sc Dra.Mayagustina Andarini,M.Sc

DNA FINGERPRINT Struktur DNA: Sidik jari (1930)----- Sidik DNA (1989) - Sidik jari dapat diubah dengan di operasi Sidik DNA: - Ada pada semua jaringan - Tidak dapat diubah Struktur DNA: Struktur molekul: C (cytosin) G (guanin) A (adenin) T (thymin) 2. Bangunan dasar nukleotida: - gula/sugar - desoksiribosa - kelompok phosphat - 4 nitrogen dasar berpasangan: A-T; C-G; G-C; T-A;

Determinasi @ Segmen DNA dideterminasi dari pasangan gula phosphat @ DNA membedakan : - Karakter - Organisme - Individu

Nucleotida (asam amino)

Chromosome

Chromosome

Kromosom 3 Diagram of a replicated and condensed metaphase eukaryotic chromosome. (1) Chromatid – one of the two identical parts of the chromosome after S phase. (2) Centromere – the point where the two chromatids touch, and where the microtubules attach. (3) Short arm. (4) Long arm. 2 4 1

KROMOSOM An image of the 46 chromosomes, making up the diploid genome of human male.

Analisis DNA Isolasi DNA: darah, rambut, kulit, sperma dsb Memotong mengukur dan mensortir (restriksi): dengan enzim restriksi asal bakteri: mis Eco RIpada sequen GAATTC 3.- Elektroforesis gel - Transfer DNA ke nylon 4. Probing: -dengan radioaktif- DNA.FP - Pewarna probDNA.FP 5. DNA. FP dengan pewarna prob lagi

Sidik DNA Setelah proses elektroporesis, kemudian diwarnai: Dengan methylen blue untuk pewarnaan gel Konvensional Pewarnaan khusus untuk peningkatan penampilan dan memudahkan pembacaan, dapat diwarnai : Dengan: - Carolina blue, atau - Quikviem DNA Kedua jenis pewarnaan ini dapat mengurangi back ground dan meningkatkan sensitiviti

POLYMERASE CHAIN REACTION (PCR) Reaksi penggandaan DNA: Diperlukan: - DNA original - dua molekul primer nukleotida utuh - larutan buffer - Taq DNA polimerases (enzim): Fungsi/kegunaanya: - Melipatgandakan DNA dengan cara mengkopi(copy) - Diagnosis untuk mengkonformasi DNA

PCR The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of the DNA. Primers (short DNA fragments) containing sequences complementary to the target region along with a DNA polymerase (after which the method is named) are key components to enable selective and repeated amplification. As PCR progresses, the DNA generated is itself used as a template for replication, setting in motion a chain reaction in which the DNA template is exponentially amplified. PCR can be extensively modified to perform a wide array of genetic manipulations.

Prosedure PCR Initialization step: This step consists of heating the reaction to a temperature of 94–96 °C (or 98 °C if extremely thermostable polymerases are used), which is held for 1–9 minutes. It is only required for DNA polymerases that require heat activation by hot-start PCR.[9] Denaturation step: This step is the first regular cycling event and consists of heating the reaction to 94–98 °C for 20–30 seconds. It causes DNA melting of the DNA template by disrupting the hydrogen bonds between complementary bases, yielding single strands of DNA. Annealing step: The reaction temperature is lowered to 50–65 °C for 20–40 seconds allowing annealing of the primers to the single-stranded DNA template. Typically the annealing temperature is about 3-5 degrees Celsius below the Tm of the primers used. Stable DNA-DNA hydrogen bonds are only formed when the primer sequence very closely matches the template sequence. The polymerase binds to the primer-template hybrid and begins DNA synthesis. Extension/elongation step: The temperature at this step depends on the DNA polymerase used; Taq polymerase has its optimum activity temperature at 75–80 °C,[10][11] and commonly a temperature of 72 °C is used with this enzyme. At this step the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTPs that are complementary to the template in 5' to 3' direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl group at the end of the nascent (extending) DNA strand. The extension time depends both on the DNA polymerase used and on the length of the DNA fragment to be amplified. As a rule-of-thumb, at its optimum temperature, the DNA polymerase will polymerize a thousand bases per minute. Under optimum conditions, i.e., if there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. Final elongation: This single step is occasionally performed at a temperature of 70–74 °C for 5–15 minutes after the last PCR cycle to ensure that any remaining single-stranded DNA is fully extended. Final hold: This step at 4–15 °C for an indefinite time may be employed for short-term storage of the reaction

Proses PCR Denaturasi annealing primer Replikasi DNA

Denaturasi (suhu 94-96oC) Dobel helix strand dipisah

Annealing Primer (suhu 50-65oC) annealing/primer melekat pada masing-masing strand

Replikasi DNA (suhu 72oC) masing-masing strand digandakan

Aplikasi DNA FP Mendiagnosis Kelainan keturunan (genetik) - pada janin yang belum dilahirkan - Bayi yang baru dilahirkan Penelitian mengenai kelainan genetik Normalbandingkan --Kelainan Bukti biologik: untuk laboratorium forensik

Penyakit Genetik Gen makhluk hidup Ling-kungan

Klasifikasi penyakit genetik

Achondroplasia

ENZIM UNTUK RESTRIKSI Enzim Organisme sequen yang dikenal ------------------------------------------------------------------------------------------------------------------------- EcoRI Escherichia coli GAATTC BamHI Bacillus amyloliquefaciens GGATCC Bgl/II bacillus globigii AGATCT PvuII proteus vulgaris CGATCG PvuIII Proteus vulgaris CAGCTG HindIII haemophilus influenzaeRd AAGCTT HinfI Haemophilus influenzaeRf GANTC Sau3A Staphylococcus aureus GATC AluI Arthrobacter luteus AGCT TaqI Thermus aquatus TCGA HaeIII haemophilus aegyptius GGCC NotI Nocardia otitidis-caviarum GCGGCCGC

Mutasi DNA

Kelainan keturunan

Kasus perselingkuhan (hal. 51)

Kasus perkosaan (hal 52)

Kasus perkosaan (hal. 53)

MINI-SATELIT Variable Number Tandem Repeat (VNTR) Pada kromosom manusia ada sequens pendek yang diulang Ulangan : dari 1-30 ulangan Dapat dipotong pada variasi jumlah tandem repeat: dengan cara hibridisasi dan probe spesifik “TAAGGGCCATAAGGGCCATAAGGGCCA”

VNTR

VNTR Ayah Ibu Ayah ---------------Anak------------------ Ibu

VNTR Single locus: memperlihatkan locus-tunggal probe VNTR sangat mudah diinterpretasikan untuk setiap individu dengan band yang tidak lebih dari dua Digunakan di Amerika untuk penyidikan forensik dan jejak keturunan Multi locus: Memperlihatkan locus-multi probe VNTR, banyak informasi yang dapat dibaca secara simultan dengan band antara 10-30 Tetapi agak susah interpretasinya Digunakan di Eropa untuk penyidikan forensik dan jejak keturunan