Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

Bagaimana mengukur diversitas genetik? - Marka molekuler - Reaksi PCR Drs. Sutarno, MSc., PhD.

Presentasi serupa


Presentasi berjudul: "Bagaimana mengukur diversitas genetik? - Marka molekuler - Reaksi PCR Drs. Sutarno, MSc., PhD."— Transcript presentasi:

1 Bagaimana mengukur diversitas genetik? - Marka molekuler - Reaksi PCR Drs. Sutarno, MSc., PhD.

2

3 Variation in skin and hair colour suggests substantial genetic diversity

4

5 MARKA GEN DALAM SELEKSI Hewan dan Tumbuhan Penggunaan Marka Gen Penggunaan Marka Gen Sifat yang memiliki nilai ekonomi tinggi umumnya bersifat kuantitatif dan dikendalikan oleh berbagai lokus pengendali sifat kuantitatif (QTL) dan juga factor lingkungan, maka tidak dapat melakukan genotyping utk sifat tsb hanya berdasarkan pada karakter fenotip. Sifat yang memiliki nilai ekonomi tinggi umumnya bersifat kuantitatif dan dikendalikan oleh berbagai lokus pengendali sifat kuantitatif (QTL) dan juga factor lingkungan, maka tidak dapat melakukan genotyping utk sifat tsb hanya berdasarkan pada karakter fenotip. Marka gen: suatu sekuen variable DNA yang terjadi secara bersamaan dengan variable sifat kuantitatif, baik secara langsung mempengaruhi atau karena akurat terhadap suatu sifat yang dinginkan. berpautan dengan sekuen DNA yg lain yang mempengaruhi suatu sifat tertentu. Marka gen: suatu sekuen variable DNA yang terjadi secara bersamaan dengan variable sifat kuantitatif, baik secara langsung mempengaruhi atau karena akurat terhadap suatu sifat yang dinginkan. berpautan dengan sekuen DNA yg lain yang mempengaruhi suatu sifat tertentu. Marka gen sangat bermanfaat  untuk melakukan seleksi secara Marka gen sangat bermanfaat  untuk melakukan seleksi secara

6 Bagaimana Memperoleh MARKA GEN dua pendekatan utama : dua pendekatan utama : 1). candidate marker dan 1). candidate marker dan 2). random marker approach. 2). random marker approach.

7 Candidate gene approach Pendekatan ini didasarkan pada pengetahuan pendukung yang telah ada seperti bukti-bukti fisiologi dan biokimia yang menunjukkan bahwa gen ybs terlibat pada sifat yang diinginkan. Misal dipilihnya gen penyandi hormon pertumbuhan untuk studi gen-gen yang mempengaruhi pertumbuhan karena produk dari gen tsb adalah sangat penting dalam pertumbuhan somatic.

8 Keuntungan pendekatan kandidat gen: Gen yang dipelajari terlibat pada sifat fenotip yg diinginkan. Gen yang dipelajari terlibat pada sifat fenotip yg diinginkan. Pendekatan ini straightforward, hanya memfokuskan pada gen yang relevan thd fenotip yang diinginkan, Pendekatan ini straightforward, hanya memfokuskan pada gen yang relevan thd fenotip yang diinginkan, Dapat sebagai penentu nilai genotip, Dapat sebagai penentu nilai genotip, Sesuai untuk analisis yang menunjukkan kontribusi lokus kandidat terhadap variasi total fenotip, Sesuai untuk analisis yang menunjukkan kontribusi lokus kandidat terhadap variasi total fenotip, Hasil yang diperoleh interpretable secara fisiologis dan biokimia, dan kandidat gen yg diinginkan dapat dilokasikan dari produk protein dengan teknik standard. Hasil yang diperoleh interpretable secara fisiologis dan biokimia, dan kandidat gen yg diinginkan dapat dilokasikan dari produk protein dengan teknik standard.

9 Langkah yang diperlukan dalam candidate gene approach: identifikasi locus/loci diinginkan berdasarkan bukti fisiologis dan biokimia yang berhubungan dengan sifat fenotip identifikasi locus/loci diinginkan berdasarkan bukti fisiologis dan biokimia yang berhubungan dengan sifat fenotip identifikasi varian molekuler pada atau sekitar locus/loci tersebut. Umumnya varian molecular dideteksi dengan teknik RFLP, PCR-RFLP, microsatellite atau teknik molecular yang lain. identifikasi varian molekuler pada atau sekitar locus/loci tersebut. Umumnya varian molecular dideteksi dengan teknik RFLP, PCR-RFLP, microsatellite atau teknik molecular yang lain. Variasi molecular dikelompokkan dalam klas genotipe, Variasi molecular dikelompokkan dalam klas genotipe, Variasi nilai fenotip dikelompokkan, Variasi nilai fenotip dikelompokkan, Gunakan uji statistik yang sesuai untuk menguji keterkaitan klas genotip dan fenotip. Gunakan uji statistik yang sesuai untuk menguji keterkaitan klas genotip dan fenotip.

10 Kelemahan kandidat gen: 1. Terbatas hanya pada sifat-sifat yang telah diketahui hubungan fisiologis dan biokimianya. 2. Variasi molekuler harus diperoleh pada locus/loci yang dipelajari.

11 Random marker approach Pendekatan random berusaha melokalisasi marka gen dengan melakukan pengukuran genotipe pada sejumlah loki yang sangat banyak (keseluruhan genome) tanpa mengetahui pengaruh fenotipnya, dengan harapan ada locus/loci yang berpautan dengan sifat yang diinginkan. Pendekatan random berusaha melokalisasi marka gen dengan melakukan pengukuran genotipe pada sejumlah loki yang sangat banyak (keseluruhan genome) tanpa mengetahui pengaruh fenotipnya, dengan harapan ada locus/loci yang berpautan dengan sifat yang diinginkan. RAPD sering digunakan dalam pendekatan ini. RAPD sering digunakan dalam pendekatan ini.

12 Keuntungan pendekatan random: Tidak hanya terbatas pada sifat-sifat yang telah diketahui keterkaitan gen secara fisiologis dan biokimianya, Tidak hanya terbatas pada sifat-sifat yang telah diketahui keterkaitan gen secara fisiologis dan biokimianya, Pendekatan ini mencari variable marker pada keseluruhan genom, sehingga lebih memungkinkan untuk diketemukannya QTL multiple bahkan pada daerah yang mungkin belum diketemukan sebelumnya yang berhubungan dengan sifat yang diinginkan. Pendekatan ini mencari variable marker pada keseluruhan genom, sehingga lebih memungkinkan untuk diketemukannya QTL multiple bahkan pada daerah yang mungkin belum diketemukan sebelumnya yang berhubungan dengan sifat yang diinginkan. Sesuai untuk melokalisir QTL dari persilangan antar populasi yang secara genetic dan fenotipe berbeda. Sesuai untuk melokalisir QTL dari persilangan antar populasi yang secara genetic dan fenotipe berbeda.

13 Kelemahan utama dari pendekatan random Susah untuk menginterpretasikan varian molekuler dalam hubungannya dengan sifat fenotip secara fisiologis dan biokimia, karena lokus yang dideteksi berasal dari daerah yang fungsinya tidak diketahui. Susah untuk menginterpretasikan varian molekuler dalam hubungannya dengan sifat fenotip secara fisiologis dan biokimia, karena lokus yang dideteksi berasal dari daerah yang fungsinya tidak diketahui. Lebih sesuai untuk mempelajari crosses dari populasi yang divergent daripada populasi alami. Lebih sesuai untuk mempelajari crosses dari populasi yang divergent daripada populasi alami. Pendekatan ini kurang valuable dibanding pendekatan kandidat. Pendekatan ini kurang valuable dibanding pendekatan kandidat.

14 Deteksi variasi genetik pada level DNA Teknik molekuler memungkinkan identifikasi variasi genetic pada level DNA. Teknik molekuler memungkinkan identifikasi variasi genetic pada level DNA. Marka genetic, seperti RFLP, microsatellite, PCR- RFLP, RAPD, sekuensing, dapat digunakan untuk memonitor variasi DNA yang bertanggungjawab terhadap variasi fenotip baik dalam suatu individu maupun inter dan antar spesies. Marka genetic, seperti RFLP, microsatellite, PCR- RFLP, RAPD, sekuensing, dapat digunakan untuk memonitor variasi DNA yang bertanggungjawab terhadap variasi fenotip baik dalam suatu individu maupun inter dan antar spesies. Pendekatan berdasarkan marka DNA memungkinkan dilakukannya usaha peningkatan produksi tanaman maupun hewan. Pendekatan berdasarkan marka DNA memungkinkan dilakukannya usaha peningkatan produksi tanaman maupun hewan.

15 PCR-based technique Visualisasi amplifikasi PCR..\Bio molekuler\PCR.EXE Visualisasi amplifikasi PCR..\Bio molekuler\PCR.EXE..\Bio molekuler\PCR.EXE..\Bio molekuler\PCR.EXE Untuk menunjukkan adanya diversitas genetik, dapat dilakukan berbagai teknik yang berbasis PCR, misalnya: Untuk menunjukkan adanya diversitas genetik, dapat dilakukan berbagai teknik yang berbasis PCR, misalnya: RAPD RAPD RFLP RFLP Mikrosatellite (vNTR) Mikrosatellite (vNTR) PCR-RFLP PCR-RFLP Sequensing dll Sequensing dll

16 Restriction Fragment Length Polymorphism (RFLP) RFLP: marka genetic dimana polimorfisme dideteksi dan divisualisasi melalui dua tahap: Digesti dengan enzim restriksi, dan Digesti dengan enzim restriksi, dan Hibridisasi dg Southern blotting Hibridisasi dg Southern blotting Fragmen yang dihasilkan dipisahkan dengan gel elektroforesis, transfer ke nitrocellulose filter, dideteksi dengan melakukan hibridisasi dengan probe yang dilabel dg radioaktif yang terdiri dari cloned DNA sequences yang homolog dg fragmen DNA yang diteliti. RFLP banyak digunakan di bidang pertanian untuk: parentage testing parentage testing investigasi lokus polimorfik yang mempengaruhi sifat-sifat tertentu untuk MAS. investigasi lokus polimorfik yang mempengaruhi sifat-sifat tertentu untuk MAS. Kelemahan utama: tidak dapat diautomatisasi untuk sample yang banyak

17 Microsatelit Marka genetic yang berdasarkan variasi panjang ulangan dari motif di-, tri-, or tetra nucleotide Marka genetic yang berdasarkan variasi panjang ulangan dari motif di-, tri-, or tetra nucleotide Variable ulangan ini dapat diamplifikasi dengan PCR yang hasilnya berupa variasui panjang fragmen yang dapt dideteksi dengan gel elektroforesis Variable ulangan ini dapat diamplifikasi dengan PCR yang hasilnya berupa variasui panjang fragmen yang dapt dideteksi dengan gel elektroforesis Lebih mudah dibanding RFLP, diperlukan informasi sekuen untuk mendesign primer. Lebih mudah dibanding RFLP, diperlukan informasi sekuen untuk mendesign primer. Pada eukaryot, dinucleotides repeats, seperti (AC)n, (AG)n and (AT)n telah banyak diidentifikasi dan sangat bervariasi. Pada eukaryot, dinucleotides repeats, seperti (AC)n, (AG)n and (AT)n telah banyak diidentifikasi dan sangat bervariasi.

18 Polymerase Chain Reaction-Restriction Fragment Length Polymorphism(PCR-RFLP) Teknik yang relative baru untuk mendeteksi variasi gen. Teknik yang relative baru untuk mendeteksi variasi gen. Gabungan antara amplifikasi PCR dengan digesti menggunakan enzim restriksi dari suatu lokus DNA. Gabungan antara amplifikasi PCR dengan digesti menggunakan enzim restriksi dari suatu lokus DNA.

19 PCR-RFLP Perubahan nukleotida karena insersi, delesi, substitusi pada situs restriksi menghasilkan perbedaan panjang fragmen DNA yang dapat divisualisasi dengan agarose gel elektroforesis. Perubahan nukleotida karena insersi, delesi, substitusi pada situs restriksi menghasilkan perbedaan panjang fragmen DNA yang dapat divisualisasi dengan agarose gel elektroforesis. Menghasilkan polimorfisme yang sama dg RFLP, namun tanpa Southern blotting. Menghasilkan polimorfisme yang sama dg RFLP, namun tanpa Southern blotting. Lebih sensitive, cepat dan akurat bila disbanding RFLP biasa. Lebih sensitive, cepat dan akurat bila disbanding RFLP biasa. DNA yang diperlukan jauh lebih sedikit (kurang dari 100ng) bila dibandingkan RFLP biasa yg memerlukan 2- 10ug DNA DNA yang diperlukan jauh lebih sedikit (kurang dari 100ng) bila dibandingkan RFLP biasa yg memerlukan 2- 10ug DNA

20 Random Amplified Polymorphic DNA (RAPD) Teknik berdasarkan amplifikasi PCR Teknik berdasarkan amplifikasi PCR Menggunakan primer oligonukleotida random yang pendek Menggunakan primer oligonukleotida random yang pendek Amplifikasi dengan primer ini menghasilkan produk yang sangat bervariasi karena masing-masing primer dapat mengamplifikasi beberapa fragmen dari lokus yang berbeda pada reaksi PCR yang sama. Amplifikasi dengan primer ini menghasilkan produk yang sangat bervariasi karena masing-masing primer dapat mengamplifikasi beberapa fragmen dari lokus yang berbeda pada reaksi PCR yang sama. Produk dapat diamati dengan agarose gel elektroforesis. Produk dapat diamati dengan agarose gel elektroforesis. Memiliki sensitivitas deteksi variasi yang tinggi, sangat berguna untuk identifikasi varitas, marka yang spesies spesifik, dan estimasi kekerabatan antar varitas. Memiliki sensitivitas deteksi variasi yang tinggi, sangat berguna untuk identifikasi varitas, marka yang spesies spesifik, dan estimasi kekerabatan antar varitas. Cepat dan efisien dalam screening polimorfisme DNA. Cepat dan efisien dalam screening polimorfisme DNA. Kelemahan: pada gen apa letak polimorfisme tidak diketahui. Kelemahan: pada gen apa letak polimorfisme tidak diketahui.

21 SEQUENSING Merupakan teknik yang lebih tangguh (tetapi lebih mahal) untuk pengujian variasi genetik. Merupakan teknik yang lebih tangguh (tetapi lebih mahal) untuk pengujian variasi genetik. Untuk mengetahui urutan susunan nukleotida. Sangat akurat, detail, hanya sgak mahal. Untuk mengetahui urutan susunan nukleotida. Sangat akurat, detail, hanya sgak mahal.

22 Alignment of growth hormone gene locus 1 sequences of different AluI genotypes with the gene sequence from genebank. Sequence similarities or differences are shown with or without asterik (*). GENEBANK GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGGAAGA GENEBANK GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGGAAGA SUT-GH2-LL GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGGAAGA SUT-GH2-LL GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGGAAGA SUT-GH1-VV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGGAAGA SUT-GH1-VV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGGAAGA SUT-GH3-LV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGGAAGA SUT-GH3-LV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGGAAGA **************************************************** ******* **************************************************** ******* GENEBANK TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT GENEBANK TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT SUT-GH2-LL TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT SUT-GH2-LL TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT SUT-GH1-VV TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT SUT-GH1-VV TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT SUT-GH3-LV GGCACCCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT SUT-GH3-LV GGCACCCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACAT ** ******************************************************* ** ******************************************************* GENEBANK GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT GENEBANK GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT SUT-GH2-LL GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT SUT-GH2-LL GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT SUT-GH1-VV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT SUT-GH1-VV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT SUT-GH3-LV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT SUT-GH3-LV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCT ************************************************************ ************************************************************ GENEBANK GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC GENEBANK GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH2-LL GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH2-LL GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH1-VV GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH1-VV GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH3-LV GCATAAGACGGAGACGTTCCTGAGGGTCATGAAGTGCCGCCGC SUT-GH3-LV GCATAAGACGGAGACGTTCCTGAGGGTCATGAAGTGCCGCCGC ***************** ************************* ***************** *************************

23 PCR Thermocycler = mesin PCR = Mesin DNA Thermocycler = mesin PCR = Mesin DNA PCR ( polymerase chain reaction ): teknik untuk mengamplifikasi (melipat gandakan) DNA secara invitro. PCR ( polymerase chain reaction ): teknik untuk mengamplifikasi (melipat gandakan) DNA secara invitro. PCR sangat spesifik, hanya fragmen DNA yang diinginkan yang diamplifikasi, dan PCR sangat spesifik, hanya fragmen DNA yang diinginkan yang diamplifikasi, dan sangat sensitif, tidak lagi memerlukan jumlah DNA dengan ukuran mikrogram, tetapi secara teori meskipun dari singel sel saja akan dapat diamplifikasi dengan PCR. sangat sensitif, tidak lagi memerlukan jumlah DNA dengan ukuran mikrogram, tetapi secara teori meskipun dari singel sel saja akan dapat diamplifikasi dengan PCR.

24 Hasil Reaksi PCR setelah elektroforesis Figure 1. Photograph of an ethidium bromide stained agarose gel showing the specificity of the PCR products (223 bp) of locus 1 spanning intron IV and Exon V of the growth hormone gene, amplified using primers GH1 and GH2. Lane 1: Madura 1 (M1), 2: (M2), 3: Bali 1 (B1), 4: (B2), 5: Ongole derived1 (PO 1), 6: PO 2. Figure 1. Photograph of an ethidium bromide stained agarose gel showing the specificity of the PCR products (223 bp) of locus 1 spanning intron IV and Exon V of the growth hormone gene, amplified using primers GH1 and GH2. Lane 1: Madura 1 (M1), 2: (M2), 3: Bali 1 (B1), 4: (B2), 5: Ongole derived1 (PO 1), 6: PO bp marker bp 100bp 600bp

25 Kegunaan PCR Untuk skrining atau sekuensing secara cepat Untuk skrining atau sekuensing secara cepat Sebagai pelacak peristiwa kriminal pada bagian forensik Sebagai pelacak peristiwa kriminal pada bagian forensik Diagnosa secara dini penyakit hepatitis B, TBC dll Diagnosa secara dini penyakit hepatitis B, TBC dll Mendeteksi bakteri patogen dalam air dan lingkungan (sensitivitas 1-10sel/100ml air). Mendeteksi bakteri patogen dalam air dan lingkungan (sensitivitas 1-10sel/100ml air).

26 Protokol reaksi PCR Siapkan campuran reaksi yang terdiri dari: Siapkan campuran reaksi yang terdiri dari: 200ng DNA template, 200ng DNA template, 0.15  M dari masing-masing oligonukleotida primer, 0.15  M dari masing-masing oligonukleotida primer, 200  M dari masing-masing dNTPs, 200  M dari masing-masing dNTPs, 2mM MgCl2, 2mM MgCl2, 10x buffer dan 10x buffer dan 1,5 unit Taq DNA polymerase  dalam 0,6ml tabung effendorf dengan total volume 50  L 1,5 unit Taq DNA polymerase  dalam 0,6ml tabung effendorf dengan total volume 50  L Kontrol negatif (tanpa DNA template) selalu disertakan dalam semua reaksi Kontrol negatif (tanpa DNA template) selalu disertakan dalam semua reaksi melakukan siklus PCR melakukan siklus PCR

27 Siklus PCR Denaturasi :94 o C, 15 detik Denaturasi :94 o C, 15 detik Primer annealing :55 o C, 30 detik Primer annealing :55 o C, 30 detik Primer extension : 72 o C, 1.5 menit Primer extension : 72 o C, 1.5 menit Akhiri siklus terakhir dengan perpanjangan pada 72 o C selama 5 menit. Kemudian hentikan dengan mendinginkan pada suhu 4 o C dan menambahkan 10mM EDTA (bila diperlukan). Akhiri siklus terakhir dengan perpanjangan pada 72 o C selama 5 menit. Kemudian hentikan dengan mendinginkan pada suhu 4 o C dan menambahkan 10mM EDTA (bila diperlukan).

28 Hal-hal penting yang perlu diperhatikan dalam reaksi PCR 1. Konsentrasi enzim Taq DNA polimerase, konsentrasi: unit per 5  L reaksi. Perlu optimisasi. Konsentrasi enzim terlalu tinggi  background non-spesifik, terlalu rendah  tidak cukup produk. Taq DNA polimerase, konsentrasi: unit per 5  L reaksi. Perlu optimisasi. Konsentrasi enzim terlalu tinggi  background non-spesifik, terlalu rendah  tidak cukup produk. 2. Konsentrasi dNTPs Konsentrasi masing-masing dNTPs: 200  M  hasil yang baik. Pengurangan konsentrasi dNTPs dapat mengurangi mispriming pada tempat-tempat bukan target, dan mengurangi kemungkinan perluasan kesalahan penggabungan nukleotida. Konsentrasi masing-masing dNTPs: 200  M  hasil yang baik. Pengurangan konsentrasi dNTPs dapat mengurangi mispriming pada tempat-tempat bukan target, dan mengurangi kemungkinan perluasan kesalahan penggabungan nukleotida.

29 3. Konsentrasi Magnesium Sangat penting untuk dioptimumkan konsentrasinya. Sangat penting untuk dioptimumkan konsentrasinya. Mg mempengaruhi: penguatan primer (primer annealing), suhu peruraian pada template, spesifikasi produk, formasi primer- dimer, dan aktifitas serta fidelitas enzim. Masing-masing reaksi PCR diperlukan mM melebihi konsentrasi dNTP. EDTA dalam stok primer dapat mengganggu konsentrasi optimum mg. Mg mempengaruhi: penguatan primer (primer annealing), suhu peruraian pada template, spesifikasi produk, formasi primer- dimer, dan aktifitas serta fidelitas enzim. Masing-masing reaksi PCR diperlukan mM melebihi konsentrasi dNTP. EDTA dalam stok primer dapat mengganggu konsentrasi optimum mg.

30 4. Primer Umumnya antara  M (+12pM lebih baik). Terlalu tinggi konsentrasi primer: terjadi kesalahan priming (mispriming) dan penumpukan hasil yg tidak spesifik serta menyebabkan munculnya primer-dimer (independent template),  produk yg diinginkan menjadi rendah. Umumnya antara  M (+12pM lebih baik). Terlalu tinggi konsentrasi primer: terjadi kesalahan priming (mispriming) dan penumpukan hasil yg tidak spesifik serta menyebabkan munculnya primer-dimer (independent template),  produk yg diinginkan menjadi rendah. Usahakan G-C content sekitar 50-60%, melting temperatur antara o C. Usahakan G-C content sekitar 50-60%, melting temperatur antara o C. Primer annealing: tergantung pada komposisi dasar, panjang dan konsentrasi primer, normalnya 5 o C dibawah melting temperaturnya (hasil terbaik biasanya antara o C). Peningkatan suhu annealing dapat menyedikirtkan kesalahan pemanjangan nukleotoda. Primer annealing: tergantung pada komposisi dasar, panjang dan konsentrasi primer, normalnya 5 o C dibawah melting temperaturnya (hasil terbaik biasanya antara o C). Peningkatan suhu annealing dapat menyedikirtkan kesalahan pemanjangan nukleotoda. Primer extension, tergantung pd panjang dan konsentrasi target sekuen serta temperatur; optimumnya 72 o C. Primer extension, tergantung pd panjang dan konsentrasi target sekuen serta temperatur; optimumnya 72 o C.

31 5. DNA template 200ng DNA template, terlalu tinggi  non-spesifik produk. 200ng DNA template, terlalu tinggi  non-spesifik produk. 6. Waktu dan suhu denaturasi Denaturasi DNA template yg tidak komplit  kegagalan PCR. Umumnya 94oC selama 30detik atau 97oC selama 15 detik cukup bagus. GC content tinggi, perlu suhu denaturasi sedikit lebih tinggi. Denaturasi DNA template yg tidak komplit  kegagalan PCR. Umumnya 94oC selama 30detik atau 97oC selama 15 detik cukup bagus. GC content tinggi, perlu suhu denaturasi sedikit lebih tinggi. 7. Jumlah siklus tergantung konsentrasi permulaan DNA target bila parameter yg lain baik. Terlalu banyak siklus  non- spesifik background; terlalu sedikit  produk sedikit. Antara umumnya memberikan hasil yg baik. tergantung konsentrasi permulaan DNA target bila parameter yg lain baik. Terlalu banyak siklus  non- spesifik background; terlalu sedikit  produk sedikit. Antara umumnya memberikan hasil yg baik.

32 Contoh produk PCR-RFLP

33 Hasil PCR-RFLP setelah dilakukan elektroforesis Figure 1. Photograph of an ethidium bromide stained agarose gel showing the specificity of the PCR products (223 bp) of locus 1 spanning intron IV and Exon V of the growth hormone gene, amplified using primers GH1 and GH2. Lane 1: Madura 1 (M1), 2: (M2), 3: Bali 1 (B1), 4: (B2), 5: Ongole derived1 (PO 1), 6: PO 2. Figure 1. Photograph of an ethidium bromide stained agarose gel showing the specificity of the PCR products (223 bp) of locus 1 spanning intron IV and Exon V of the growth hormone gene, amplified using primers GH1 and GH2. Lane 1: Madura 1 (M1), 2: (M2), 3: Bali 1 (B1), 4: (B2), 5: Ongole derived1 (PO 1), 6: PO bp marker bp 100bp 600bp

34 Figure 2. Gel photographs showing growth hormone gene polymorphisms detected by PCR-RFLP using Alu I in locus 1 fragment. Lane1 = LV, Lane 2 = VV, Lane 3 = LL, and lane 4 = Uncut. Figure 2. Gel photographs showing growth hormone gene polymorphisms detected by PCR-RFLP using Alu I in locus 1 fragment. Lane1 = LV, Lane 2 = VV, Lane 3 = LL, and lane 4 = Uncut. 100bp marker bp 100bp 600bp 171bp 52bp


Download ppt "Bagaimana mengukur diversitas genetik? - Marka molekuler - Reaksi PCR Drs. Sutarno, MSc., PhD."

Presentasi serupa


Iklan oleh Google