Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

Memahami Urutan Genom Kuliah Umum BB Biogen 22 Januari 2013 Habib Rijzaani Laboratorium Genomika & Bioinformatika.

Presentasi serupa


Presentasi berjudul: "Memahami Urutan Genom Kuliah Umum BB Biogen 22 Januari 2013 Habib Rijzaani Laboratorium Genomika & Bioinformatika."— Transcript presentasi:

1 Memahami Urutan Genom Kuliah Umum BB Biogen 22 Januari 2013 Habib Rijzaani Laboratorium Genomika & Bioinformatika

2 Manual Kehidupan ‎"Life DOES come with instructions, read them." VisiGen on DNA Sequencing

3 Gen vs Genom

4

5 Gen vs. Genom Gen: Genetika (genetics) 1 atau beberapa gen zoom-in Genom: Genomika (genomics) Banyak atau seluruh gen zoom-out

6 -om & -omika Genom (gen+kromosom, Prof. Hans Winkler, 1920), genomika (1980-an), -omika (1990-an) -om: obyek kajian, -omika: bidang kajian Arti: total atau keseluruhan genom+bioinformatika (2000-an): Genomika, metagenomika, transkriptomika, epigenomika, proteomika, metabolomika, nutrigenomika, farmakogenomika, toksikogenomika, glikomika, ekspresomika...

7 -omika “Omika adalah istilah umum untuk sebuah bidang ilmu sains dan teknik yang mempelajari interaksi obyek informasi hayati dalam berbagai 'om'. [...] Fokus utamanya adalah: 1) pemetaan obyek informasi seperti gen, protein dan ligan; 2) menemukan jalinan interaksi antar obyek; 3) merekayasa jaringan dan obyek untuk memahami dan memanipulasi mekanisme pengaturan; dan 4) menggabungkan aneka -om dan sub-bidang -omika.” omics.org

8 Pengurutan Genom Gen. 1 Sanger, 1975 Berbasis kloning, PCR dan elektroforesis (gel/kapiler) pb

9 Metode Sanger

10 Sanger utk. Genom Shotgun sequencing Genom bakteri Haemophilus influenzae 1,830,137 pb potongan (50K reads) Program bionformatika utk. merakit urutan genom utuh

11 Shotgun Sequencing Genom Bacaan acak Perakitan Rangka Urutan Genom Berjenjang Seluruh Genom

12 Pengurutan Genom: Gen (30 tahun setelah Sanger)

13 Pengurutan Genom: Gen. 2 Next-generation sequencing (NGS) Tanpa kloning! Pemain (kimia) 454/Roche (pyrosequencing) Solexa/Illumina (reversible terminator) Solid/ABI (sequencing-by-ligation)

14 HiSeq2000

15 Illumina/Solexa sequencing Pemotongan genom Penambahan adapter Pustaka DNA genom Pembentukan gugus Perbanyakan potongan genom pada flow cell lewat PCR Solid-state cloning Pembacaan urutan

16 Penyiapan Pustaka Genom Pemotongan Genom Nebulizer (gas) Sonicator (suara) g-Tube (gaya sentrifugal) Transposon (enzim)

17 Penyortiran ukuran potongan Proses pembentukan gugus dan pembacaan DNA oleh mesin sekuenser hanya efektif pada panjang potongan DNA tertentu (100 – 500 pb)

18 Penempelan adapter Adapter untuk manipulasi dalam proses lanjutan Barcode, indeks Pemilihan ukuran & kuantifikasi Bioanalyzer, qPCR

19 cBOT Robot pembuat cluster (gugus)

20 Pembentukan Gugus Penempelan potongan DNA dari pustaka genom ke flow cell & perbanyakan molekul DNA membentuk gugus an molekul melalui PCR

21 Pembacaan urutan DNA Illumina: pengurutan melalui sintesis (sequencing-by-synthesis, SBS)

22 Pembacaan urutan DNA Siklus 1 Siklus 2 Siklus 3 Siklus 4 Siklus 5, Bacaan 1: GCTGA Bacaan 2: AGCCG 1 lajur flow cell => juta gugus/bacaan

23 Pembacaan urutan DNA Single-end & Paired-end reads Bacaan ujung tunggal & ujung berpasangan

24 Pengurutan Genom: Gen. 3 Tanpa perbanyakan potongan DNA! Langsung dari 1 molekul DNA Nanoteknologi, semikonduktor, sensor plasma Helicos Ion Torrent Mendeteksi pelepasan proton saat penyisipan dNTP oleh polimerase Pacific Biosciences Single molecule real time (SMRT) sequencing

25 Helicos

26 Ion Torrent

27 Pac Bio

28 Perbandingan Sanger 800 nt ~80 kb Roche / nt 0.5 Gb AB / SOLiD2x 50 nt 60 Gb Illumina / Solexa2x100 nt 300 Gb

29 read length bases per machine run 10 bp1,000 bp100 bp 1 Gb 100 Mb 10 Mb 10 Gb AB/SOLiDv3, Illumina/GAII short-read sequencers ABI capillary sequencer 454 GS FLX pyrosequencer ( Mb in bp reads, 0.5-1M reads, 5-10 hours) (10+Gb in bp reads, >100M reads, 4-8 days) 1 Mb ( Mb in bp reads, 96 reads, 1-3 hours) 100 Gb From John McPherson, OICR Perbandingan

30 Perakitan urutan genom Selayang pandang proses pembacaan seluruh genom dengan teknik shotgun. Reads Potongan DNA genom Contigs Scaffolds Pemetaan scaffolds Peta genom

31 Gambaran menyeluruh dari semua reads yang saling bersambung dan membentuk sebuah contig. Tampilan dekat: urutan basa dari contig yang terbentuk. Tampilan dekat: urutan basa dari tiap read (bacaan) dan posisinya dalam contig (sambungan). Perakitan urutan genom

32 Istilah Read (bacaan) Contig (sambungan) Scaffold (rangka) Gap (celah) Celah fisik dan celah urutan Coverage (liputan) Depth (kedalaman) Quality score (skor kualitas basa)

33 Coverage depth (dalamnya liputan) Coverage is the term used to quantify the extent to which a large assembly object is covered by instances of smaller objects. The three contexts in which coverage is most often discussed are read coverage of a genome, read coverage of a contig Ukuran genom 1 Mb Sekuensing: 1 juta bacaan, 100 pb Liputan: panjang total bacaan/ukuran genom (1 juta X 100 pb) / 1 juta pb = 100X

34 Panjang potongan genom:L jumlah bacaan: n panjang tiap bacaan:l Definisi: Coverage C = n l / L Berapa liputan yang cukup? Model Lander-Waterman: Dengan asumsi sebaran bacaan yang seragam, C=10 akan menghasilkan 1 celah per 1 juta nukelotida. C n L

35 Q30 Skor kualitas basa Skala phred QV = - 10 * log10(Pe) Pe= kemungkinan salah. Q30: kemungkinan salah 1/ % benar Phred QualityP error (obs. base) % % % % % % % % %

36 Hasil N:0:1 TTATGTGTTTATTACGTTNTTTG......AATGTTTA TTTACGGGTTATTTA + hhhhhhghhhhhhghdeeBee__......hfhhghhg hhghfffaehghhcX Berkas format Fastq Setiap basa memiliki kode skor kualitas

37 Distribusi skor kualitas basa

38 Harga Genom

39

40 Penerapan Pengurutan DNA, analisa pengaturan gen, analisa ekspresi RNA, penemuan SNP dan variasi DNA struktural, GWAS, analisa interaksi protein-DNA (Chip-Seq), analisa DNA metilasi, analisa small RNA, de novo metagenomika, metatranskriptomika, sekuensing amplikon,... Mesin sama, pendekataan berbeda dalam: Penyiapan sampel/pustaka genom Analisa data/bioinformatika

41 Genomika Fungsional Sekuen genom + Koleksi mutan Penyisipan T-DNA, penandaan transposon, mutagen kimiawi Profil ekspresi gen menyeluruh Microarray, EST, pustaka cDNA, transkriptom Sekuen genom lain Plasma nutfah terkait, spesies lain Anotasi Prediksi struktur dan fungsi gen (gene ontology), sekuen pengatur

42 Anotasi >contig-1 GAAAGATCGCTGGTTACAACCGAATATACAGC CTCTAATCACTTTTTTTCTGCTCTGTAATCGT TCGCGGTTTCTGCGGCCATAAAATAAAGTAA ATCCGAGTTAAACGCTGATAGTCGCGCCTG AAGAACCACAGAAAAAACAGAAAATATCTCC CGTCGTTTCTCGTTCTCGTTTCCG APA INI?

43 Anotasi >gi| Glycine max protein HEADING DATE 3A-like (LOC ) ATGGACCCTCTTGTCATTGGACGTGTAGTAGG AGATGTTTTGGAGCCTTTCACTAGTTGCGTC TCTCTTA FEATURES Location/Qualifiers source /organism="Glycine max" /chromosome="18" gene /note="protein HEADING DATE 3A-like"

44 Anotasi Memahami urutan genom Urutan genom (sambungan/rangka) Tingkat DNA: Dimana exon, intron, situs awal transkripsi, translasi, promoter, homologi Tingkat protein: Motif, domain, situs aktif, enzim Tingkat proses: Seluler, lokasi dalam sel, fungsi dalam sel, alur biokimia

45

46 Penerapan De novo Sequencing Perakitan genom tanpa rujukan Draft vs. Finished Contig (sambungan) dan scaffold (rangka) yang panjang Chromosome Targeted Resequencing Fokus pada daerah tertentu: exon, motif, family Multiplex (sekali perunutan, banyak sampel)

47 Penerapan Epigenetika Metilasi DNA (ChipSeq) Modifikasi histon Kemudahan akses kromatin Metagenomika De novo sequencing sampel lingkungan Keragaman 16S DNA metatranskriptom

48 Contoh A complete reference genome sequence is indeed a valuable resource, but the key to crop improvement is finding and exploiting genetic variation. Urutan genom rujukan itu berharga, tetapi kunci pemuliaan tanaman adalah menemukan dan memanfaatkan variasi genetis

49 Contoh A map of rice genome variation reveals the origin of cultivated rice Nature Oct 25;490(7421): Sequencing: 1529 genom padi: 446 Oryza rufipogon (paired-end, 2X coverage) 1083 Oryza sativa (paired-end, 1X coverage) 15 genom pembanding (outgroup, wild oryza 3X coverage) 1 O. Rufipogon (100X coverage, de novo), 1 outgroug (50X coverage)

50 Metode Pemetaan thd. genom rujukan Identifikasi SNP Genetika populasi GWAS Populasi pemetaan, BIL & CSSL Asosiasi fenotipe Anotasi BLAST, prediksi model gen, lokasi SNP

51 Contoh Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes Xun Xu, Susan McCouch et al nature biotechnology VOLUME 30 NUMBER 1 JANUARY 2012 Cultivar: 40 Japonica: 24 Indica: 12 Wild type: 10 Rufipogon: 5 Nivara: 5

52 Hasil Jutaan SNP teridentifikasi Menguak proses domestikasi padi: Japonica dan indica secara independen didomestikasi Japonica bernenek moyang O. Rufipogon dari China Penemuan gen Ribuan gen terseleksi selama proses domestikasi, mungkin penting secara agronomis Penemuan marka SNP untuk pemuliaan padi

53

54

55 Terima kasih


Download ppt "Memahami Urutan Genom Kuliah Umum BB Biogen 22 Januari 2013 Habib Rijzaani Laboratorium Genomika & Bioinformatika."

Presentasi serupa


Iklan oleh Google