Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

Isolasi Gen α-Amilase B. aquimaris MKSC 6.2 dengan Teknik Degenerate PCR dan Inverse PCR Fernita Puspasari.

Presentasi serupa


Presentasi berjudul: "Isolasi Gen α-Amilase B. aquimaris MKSC 6.2 dengan Teknik Degenerate PCR dan Inverse PCR Fernita Puspasari."— Transcript presentasi:

1 Isolasi Gen α-Amilase B. aquimaris MKSC 6.2 dengan Teknik Degenerate PCR dan Inverse PCR Fernita Puspasari

2  -1,4-glikosidik  -1,6-glikosidik dekstrin oligosakarida linier glukosa maltosa amilopektin amilosa α-Amilase Hidrolisis ikatan  -1,4 glikosidik polisakarida Protein multidomain Aplikasi: makanan, detergen, kertas, tekstil, bioetanol

3 Hidrolisis pati: gelatinisasi suhu ↑, biaya ↑  -Amilase pendegradasi pati mentah: biaya ↓, menyederhanakan proses konversi pati. Suspensi pati sakarifikasi gelatinisasi likuefaksi 105 o C α-amilase termostabil o C glukoamilase Industri Pengolahan Pati

4 Sampel Bacillus aquimaris MKSC 6.2 Bakteri laut, berasosiasi dengan koral lunak Sinularia sp.  perairan P. Merak Kecil Identifikasi bakteri: penjajaran urutan nukleotida gen 16S rRNA

5 1: Bacillus aquimaris MKSC 6.2 2: bakteri yang tidak mampu mendegradasi pati mentah Media: marine agar plate+1% pati kentang mentah+KI/I2 Kemampuan mendegradasi pati mentah 1 hari 2 hari 1 2

6 5 µm 10 µm 5 µm 10 µm1 µm 5 µm 10 µm 5 µm 10 µm 1 µm jagung singkong sagukentangberas Scanning Electron Microscopy

7 Belum ada informasi genom B. aquimaris Bagaimana mengisolasi gen α-amilase B. aquimaris Konstruksi perpustakaan genom (genomic library) PCR

8 Konstruksi Koleksi Genom Parsial

9 DNA genom DNA vektor potong ligasi Transformasi E.coli potong Penapisan. Enzim restriksi -Uji aktivitas -Hibridisasi DNA -Hibridisasi protein

10 Koleksi Genom Parsial B. aquimaris plasmid sisipan Pemotongan dengan EcoR I pb pb pb pb pb pb λ/Hind III genom B. aquimaris/EcoR I Diperoleh 5000 koloni transforman Masalah: penapisan  false positive

11 Basic Local Alignment Search Tool (BLAST)

12 NoClone5’-end3’-end 1.66(4)Ribosomal protein (S18)-alaninine acetyltransferase (Bacillus sp. SG-1), 65% identity Peptidase M22 glycoprotease (B. weihenstephanensis), 62% identity 2.36(7)Aspartate aminotransferase (Bacillus sp. SG-1), 68% identity. ATP-dependent DNA helicase/ DNA pol. III subunit ε (Bacillus sp. SG-1), 69% identity 3.59(10)ATP-dependent DNA helicase (Bacillus sp. SG-1), 68% identity Glycrone-kinase protein (Bacillus sp. SG-1), 72% identity 4.10(7)N-acetylmuromoyl-L-alanine amidase (B. coahuilensis), 40% identity Polysaccharide biosynthesis protein (Pelobacter carbinolicus), 42% identity 5.45(13)Epidermal surface antigen (Bacillus sp. SG-1), 91% identity Epidermal surface antigen (Bacillus sp. SG-1), 74% identity Analisis in silico ±800 bp

13 Degenerate PCR

14 Komponen PCR Templat DNA polimerase Bufer DNA polimerase dNTP Primer forward (degenerate) Primer reverse (degenerate) forward reverse

15 Degenerate Primer >< specific primer Campuran primer yang mirip Dirancang dari urutan asam amino yang telah diketahui atau hasil penjajaran gen yang sama dari beberapa organisme lain yang telah diketahui

16 Empat Daerah Lestari Keluarga  -Amilase AC B

17 B. coahulensis Bacillus sp. SG-1 B. weihestephanensis B. coahuilensis

18 B. weihestephanensis B. coahuilensis Bacillus sp. SG-1 B. licheniformis B. subtilis

19 Ac. No.Organisme IIIIVV ZP_ B. coahuilensis MKVILDFVV NHVG IDGYRLDTV RHV FIDNH D PIVYYGSEIA LNG ZP_ Bacillus sp. SG-1 MKIVLDFIV NHVG IDGYRLDTV RHV FIDNH D PILYYGSEIA LSG YP_ B. weihenstephanen sis IKVMLDAVF NHSG IDGWRLDVA NEV LLDSH D PCIYYGDEIG MDG ZP_ B. coahuilensis IKVMLDAVF NHSG IDGWRLDVA NEV LIGSH D PCIYYGDEIG LTG Daerah Lestari berbagai Bacillus

20

21 PrimerRegionUrutanntambgTm F1IGAYTTYRTYGTSAATCAYGTYGG F2IIGAYGGRTAYCGTCTRGATACYG22558,95 62 R1IICRGTATCYAGACGRTAYCCRTC22558,95 62 R2IVAATCGWMYCATATCATGGTTATC23355,64 60 R3VCGYTTAAAGCAATTTCWGATCC22257,08 60 R4VCAGATCCRTAGTAAASAATSGG Rancangan Primer

22

23 Perancangan Degenerate Primer Panjang: ~20 (18-24) Ujung 3’: G/C 3 basa di ujung 5’ dan 3’ tidak boleh komplemen %GC: 40-60, Tm: ~60 o C Ujung 3’: hindari degenerate, dipillih basa yang pasti

24 x normal Variasi jumlah primer Pengaruh jumlah primer Primer yang diperlukan pada degenerate PCR jauh lebih banyak daripada PCR biasa (5-10X) Normal: 20 pmol/50 μL reaksi Degenerate: pmol/50 μL reaksi

25 For 1For 2 Rev 1 Rev 2 Rev Rev pb Isolasi gen α-amilase: degenerate PCR Rujukan penomoran: gen α-amilase Bacillus sp. SG1

26 Inverse PCR

27 Komponen PCR Templat DNA polimerase Bufer DNA polimerase dNTP Primer forward (spesifik) Primer reverse (spesifik) 643 pb forwardreverse

28 Inverse PCR kromosom Enzim restriksi Self-ligasi PCR Hasil PCR

29 Cla I Harus ada daerah yang telah diketahui urutannya dengan pasti: menentukan enzim restriksi, merancang primer spesifik

30 InvF InvR ClaI InvR InvF ClaI InvR InvF ClaI Pemotongan dengan enzim restriksi Self-ligasi PCR

31 Isolasi gen α-amilase: inverse PCR ClaI HindIII HindIII Rujukan penomoran: gen α-amilase Bacillus sp. SG1 643 pb 838 pb 1326 pb 1539 pb

32 ATGAAAAGAAGAGTACTATCTCTCATTTTAGTCCCGTTTCTTCTTTTTTACGCCCTTCCGGTAGGTGCAGTTGAAAAAGAAGAACGAAAG M K R R V L S L I L V P F L L F Y A L P V G A V E K E E R K TGGCAGGATGAAACAATTTATTTCCTAATGGTAGATCGCTTTAACAATGGTGATCCAACAAATGATAAAGAAGTGAACACAAAGGATCCC W Q D E T I Y F L M V D R F N N G D P T N D K E V N T K D P AAGGCTTACCATGGCGGTGATTTCCAAGGGGTTATCGATCGATTGGATTACATCAAAGATATGGGATTCACTTCCATATGGCTGACTCCC K A Y H G G D F Q G V I D R L D Y I K D M G F T S I W L T P GTATTTGACAACCAGCCAAAAGGATACCATGGATATTGGATTACGGACTTTTATAAGACCGACGAGCATTTCGGTACGATGGAAACGTTC V F D N Q P K G Y H G Y W I T D F Y K T D E H F G T M E T F AAAAAGCTTGTAGAAGAAGCACATAAGCGGGATATGAAAGTCGTCCTTGATTTTGTGGTTAACCATGTGGGGCCGGAGCATCCCTGGGTG K K L V E E A H K R D M K V V L D F V V N H V G P E H P W V GATGACCCTGCAAAAGAAGACTGGTTCCACGAAAAACAGCCAATGAACTTCTCCGACAAAGAAAGTCTTCAGAACGCATGGCTGTATGAC D D P A K E D W F H E K Q P M N F S D K E S L Q N A W L Y D CTTCCTGATTTAAACACAGAGAATCCCGAAGTAAGGGAATATCTCTTTGATGCTGCCAAATGGTGGATCAAAGAAACGGATGTCGACGGT L P D L N T E N P E V R E Y L F D A A K W W I K E T D V D G TATCGTCTGGACACGGTGCGCCATGTTCCACAAGATTTTTGGAGTGATTTCAGTAAAGAAGTTAAATCAGTGAAAGACGATTTTTATCTT Y R L D T V R H V P Q D F W S D F S K E V K S V K D D F Y L CTTGGTGAAGTGTTTGATCGTGACCCACAGAAGATAGCAGAATATAACGATGTGGGTATCGATGGATTCGTTAATTTCCCCCAAGCTGAA L G E V F D R D P Q K I A E Y N D V G I D G F V N F P Q A E GAATTACGTTCAGTGTTTAACAAACCTGATACTTCAATGGACAGGTTGTTCAATTTCTGGAAGTACAATGAAACATTTTATGAAGATCCT E L R S V F N K P D T S M D R L F N F W K Y N E T F Y E D P TATTTGATGGGGACTTTTATAGACAACCATGATATGGAACGTTTTACACGTTTATTGGTACAGGAAAATGTTTTCCCTGGTACCCGTTGG Y L M G T F I D N H D M E R F T R L L V Q E N V F P G T R W AAACTCGCCTTGACATATATGTACACGACTCCGGGAATACCGATTGTGTATTATGGGTCTGAAATTGCCATGGATGGCGGGGAAGACCCG K L A L T Y M Y T T P G I P I V Y Y G S E I A M D G G E D P GATAACCGGCGGTTGATGAATTTCAGGGCCGACAAAGAACTGATTGATTACATTTCAAAACTGGGCAAGGTTCGAAAGGACTATCCTGCT D N R R L M N F R A D K E L I D Y I S K L G K V R K D Y P A TTGACAAGAGGAACGATAGAGCCGTTGTATGAACAAGACGGATTGGGAATATATAAACGCGCATACAAAGATCAAACGGTGGTTGTAGCC L T R G T I E P L Y E Q D G L G I Y K R A Y K D Q T V V V A ATCAATAATTCCAGTGAGACCCAAACTGTCGAACTTGATGAAGGGGAGCTTGCTGATAACAATGAACTAAAAGGGTTACTTTCAGATGAC I N N S S E T Q T V E L D E G E L A D N N E L K G L L S D D CTGGTGAGAAGCGATGAAAACGGGACGTATAAAGTCGCTTTGGATCGTGAAGAAGCAGAGATTTATCTGCTTAAAGCCAAAAGTGGACTG L V R S D E N G T Y K V A L D R E E A E I Y L L K A K S G L AACATCCCATATTTATCAGCACTTGCTGCGGTGTATGTATTATTTTTATTATTTATTTATCTAGTATGGAAACGCGGAAGAAAAAACCGC N I P Y L S A L A A V Y V L F L L F I Y L V W K R G R K N R AAATCATAA 1539 bp K S. 512 aa Urutan Gen  -Amilase B. aquimaris MKSC 6.2


Download ppt "Isolasi Gen α-Amilase B. aquimaris MKSC 6.2 dengan Teknik Degenerate PCR dan Inverse PCR Fernita Puspasari."

Presentasi serupa


Iklan oleh Google