Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

MARKA GEN DALAM SELEKSI TANAMAN Penggunaan Marka Gen Penggunaan Marka Gen Sifat yang memiliki nilai ekonomi tinggi umumnya bersifat kuantitatif dan dikendalikan.

Presentasi serupa


Presentasi berjudul: "MARKA GEN DALAM SELEKSI TANAMAN Penggunaan Marka Gen Penggunaan Marka Gen Sifat yang memiliki nilai ekonomi tinggi umumnya bersifat kuantitatif dan dikendalikan."— Transcript presentasi:

1 MARKA GEN DALAM SELEKSI TANAMAN Penggunaan Marka Gen Penggunaan Marka Gen Sifat yang memiliki nilai ekonomi tinggi umumnya bersifat kuantitatif dan dikendalikan oleh berbagai lokus pengendali sifat kuantitatif (QTL) dan juga factor lingkungan, maka tidak dapat melakukan genotyping utk sifat tsb hanya berdasarkan pada karakter fenotip. Sifat yang memiliki nilai ekonomi tinggi umumnya bersifat kuantitatif dan dikendalikan oleh berbagai lokus pengendali sifat kuantitatif (QTL) dan juga factor lingkungan, maka tidak dapat melakukan genotyping utk sifat tsb hanya berdasarkan pada karakter fenotip. Marka gen: suatu sekuen variable DNA yang terjadi secara bersamaan dengan variable sifat kuantitatif, baik secara langsung mempengaruhi atau karena berpautan dengan sekuen DNA yg lain yang mempengaruhi suatu sifat tertentu. Marka gen: suatu sekuen variable DNA yang terjadi secara bersamaan dengan variable sifat kuantitatif, baik secara langsung mempengaruhi atau karena berpautan dengan sekuen DNA yg lain yang mempengaruhi suatu sifat tertentu. Marka gen sangat bermanfaat  untuk melakukan seleksi secara akurat terhadap suatu sifat yang dinginkan. Marka gen sangat bermanfaat  untuk melakukan seleksi secara akurat terhadap suatu sifat yang dinginkan. dua pendekatan utama : 1). candidate marker dan dua pendekatan utama : 1). candidate marker dan 2). random marker approach. 2). random marker approach.

2 Candidate gene approach Pendekatan ini didasarkan pada pengetahuan pendukung yang telah ada seperti bukti-bukti fisiologi dan biokimia yang menunjukkan bahwa gen ybs terlibat pada sifat yang diinginkan. Misal dipilihnya gen penyandi hormon pertumbuhan untuk studi gen-gen yang mempengaruhi pertumbuhan karena produk dari gen tsb adalah sangat penting dalam pertumbuhan somatic. Keuntungan pendekatan kandidat gen: Gen yang dipelajari terlibat pada sifat fenotip yg diinginkan. Pendekatan ini straightforward, hanya memfokuskan pada gen yang relevan thd fenotip yang diinginkan, Dapat sebagai penentu nilai genotip, Sesuai untuk analisis yang menunjukkan kontribusi lokus kandidat terhadap variasi total fenotip, Hasil yang diperoleh interpretable secara fisiologis dan biokimia, dan kandidat gen yg diinginkan dapat dilokasikan dari produk protein dengan teknik standard.

3 Candidate gene approach Langkah yang diperlukan: identifikasi locus/loci diinginkan berdasarkan bukti fisiologis dan biokimia yang berhubungan dengan sifat fenotip identifikasi varian molekuler pada atau sekitar locus/loci tersebut. Umumnya varian molecular dideteksi dengan teknik RFLP, PCR-RFLP, microsatellite atau teknik molecular yang lain. Variasi molecular dikelompokkan dalam klas genotipe, Variasi nilai fenotip dikelompokkan, Gunakan uji statistik yang sesuai untuk menguji keterkaitan klas genotip dan fenotip. Kelemahan kandidat gen: Terbatas hanya pada sifat-sifat yang telah diketahui hubungan fisiologis dan biokimianya. Variasi molekuler harus diperoleh pada locus/loci yang dipelajari.

4 Random marker approach Pendekatan random berusaha melokalisasi marka gen dengan melakukan pengukuran genotipe pada sejumlah loki yang sangat banyak (keseluruhan genome) tanpa mengetahui pengaruh fenotipnya, dengan harapan ada locus/loci yang berpautan dengan sifat yang diinginkan. RAPD sering digunakan dalam pendekatan ini. Keuntungan pendekatan random: Tidak hanya terbatas pada sifat-sifat yang telah diketahui keterkaitan gen secara fisiologis dan biokimianya, Pendekatan ini mencari variable marker pada keseluruhan genom, sehingga lebih memungkinkan untuk diketemukannya QTL multiple bahkan pada daerah yang mungkin belum diketemukan sebelumnya yang berhubungan dengan sifat yang diinginkan. Sesuai untuk melokalisir QTL dari persilangan antar populasi yang secara genetic dan fenotipe berbeda. Kelemahan utama dari pendekatan ini: Susah untuk menginterpretasikan varian molekuler dalam hubungannya dengan sifat fenotip secara fisiologis dan biokimia, karena lokus yang dideteksi berasal dari daerah yang fungsinya tidak diketahui. Lebih sesuai untuk mempelajari crosses dari populasi yang divergent daripada populasi alami. Pendekatan ini kurang valuable dibanding pendekatan kandidat.

5 Deteksi variasi genetik pada level DNA Teknik molekuler memungkinkan identifikasi variasi genetic pada level DNA. Marka genetic, seperti RFLP, minisatellite, microsatellite, PCR-RFLP and RAPD (Cushwa & Medrano, 1996), dapat digunakan untuk memonitor variasi DNA yang bertanggungjawab terhadap variasi fenotip baik dalam suatu individu maupun inter dan antar spesies. Pendekatan berdasarkan marka DNA memungkinkan dilakukannya usaha peningkatan produksi tanaman.

6 Restriction Fragment Length Polymorphism (RFLP) RFLP: marka genetic dimana polimorfisme dideteksi dan divisualisasi melalui dua tahap: Digesti dengan enzim restriksi, dan Hibridisasi dg Southern blotting Fragmen yang dihasilkan dipisahkan dengan gel elektroforesis, transfer ke nitrocellulose filter, dideteksi dengan melakukan hibridisasi dengan probe yang dilabel dg radioaktif yang terdiri dari cloned DNA sequences yang homolog dg fragmen DNA yang diteliti. RFLP banyak digunakan di bidang pertanian untuk: parentage testing investigasi lokus polimorfik yang mempengaruhi sifat-sifat tertentu untuk MAS. Kelemahan utama: tidak dapat diautomatisasi untuk sample yang banyak

7 Microsatelit Microsatelit Marka genetic yang berdasarkan variasi panjang ulangan dari motif di-, tri-, or tetra nucleotide Variable ulangan ini dapat diamplifikasi dengan PCR yang hasilnya berupa variasui panjang fragmen yang dapt dideteksi dengan gel elektroforesis Lebih mudah disbanding RFLP, diperlukan informasi sekuen untuk mendesign primer. Pada eukaryot, dinucleotides repeats, seperti (AC)n, (AG)n and (AT)n telah banyak diidentifikasi dan sangat bervariasi.

8 Polymerase Chain Reaction- Restriction Fragment Length Polymorphism (PCR-RFLP) Teknik yang relative baru untuk mendeteksi variasi gen. Gabungan antara amplifikasi PCR dengan digesti menggunakan enzim restriksi dari suatu lokus DNA. Perubahan nukleotida karena insersi, delesi, substitusi pada situs restriksi menghasilkan perbedaan panjang fragmen DNA yang dapat divisualisasi dengan agarose gel elektroforesis. Menghasilkan polimorfisme yang sama dg RFLP, namun tanpa Southern blotting. Lebih sensitive, cepat dan akurat bila disbanding RFLP biasa. DNA yang diperlukan jauh lebih sedikit (kurang dari 100ng) bila dibandingkan RFLP biasa yg memerlukan 2-10  g DNA

9 Random Amplified Polymorphic DNA (RAPD) Teknik berdasarkan amplifikasi PCR Menggunakan primer oligonukleotida random yang pendek Amplifikasi dengan primer ini menghasilkan produk yang sangat bervariasi karena masing-masing primer dapat mengamplifikasi beberapa fragmen dari lokus yang berbeda pada reaksi PCR yang sama. Produk dapat diamati dengan agarose gel elektroforesis. Memiliki sensitivitas deteksi variasi yang tinggi, sangat berguna untuk identifikasi varitas, marka yang spesies spesifik, dan estimasi kekerabatan antar varitas. Cepat dan efisien dalam screening polimorfisme DNA. Kelemahan: pada gen apa letak polimorfisme tidak diketahui.

10 SEQUENSING Merupakan teknik yang lebih tangguh (tetapi lebih mahal) untuk pengujian variasi genetik. Merupakan teknik yang lebih tangguh (tetapi lebih mahal) untuk pengujian variasi genetik. Untuk mengetahui urutan susunan nukleotida. Sangat akurat, detail, hanya sgak mahal. Untuk mengetahui urutan susunan nukleotida. Sangat akurat, detail, hanya sgak mahal.

11 Alignment of growth hormone gene locus 1 sequences of different AluI genotypes with the gene sequence from genebank. Sequence similarities or differences are shown with or without asterik (*). GENEBANK GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGG AAGA GENEBANK GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGG AAGA SUT-GH2-LL GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGG AAGA SUT-GH2-LL GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGCTGG AAGA SUT-GH1-VV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGG AAGA SUT-GH1-VV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGG AAGA SUT-GH3-LV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGG AAGA SUT-GH3-LV GCTGCTCCTGAGGGCCCTTCGGCCTCTCTGTCTCTCCCTCCCTTGGCAGGAGGTGG AAGA **************************************************** ******* **************************************************** ******* GENEBANK TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT GENEBANK TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT SUT-GH2-LL TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT SUT-GH2-LL TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT SUT-GH1-VV TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT SUT-GH1-VV TGGCACCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT SUT-GH3-LV GGCACCCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT SUT-GH3-LV GGCACCCCCCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAA ACAT ** ******************************************************* ** ******************************************************* GENEBANK GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT GENEBANK GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT SUT-GH2-LL GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT SUT-GH2-LL GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT SUT-GH1-VV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT SUT-GH1-VV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT SUT-GH3-LV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT SUT-GH3-LV GCGCAGTGACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGG ACCT ******************************************************** **** ******************************************************** **** GENEBANK GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC GENEBANK GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH2-LL GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH2-LL GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH1-VV GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH1-VV GCATAAGACGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGC SUT-GH3-LV GCATAAGACGGAGACGTTCCTGAGGGTCATGAAGTGCCGCCGC SUT-GH3-LV GCATAAGACGGAGACGTTCCTGAGGGTCATGAAGTGCCGCCGC ***************** ************************* ***************** *************************

12 DASAR-DASAR APLIKASI TEKNIK PCR PCR (polymerase chain reaction): teknik untuk mengamplifikasi (melipat gandakan) DNA secara invitro. PCR sangat spesifik, hanya fragmen DNA yang diinginkan yang diamplifikasi, dan sangat sensitif, tidak lagi memerlukan jumlah DNA dengan ukuran mikrogram, tetapi secara teori meskipun dari singel sel saja akan dapat diamplifikasi dengan PCR. Tiga tahap PCR: Denaturasi, annealing dan extension. PCR dapat digunakan: Untuk skrining atau sekuensing secara cepat Sebagai pelacak peristiwa kriminal pd bagian kedokteran kehakiman Diagnosa secara dini penyakit hepatitis B, TBC dll Mendeteksi bakteri patogen dalam air dan lingkungan (sensitivitas 1-10sel/100ml air).

13 DASAR-DASAR APLIKASI TEKNIK PCR Protokol reaksi PCR Siapkan campuran reaksi yang terdiri dari: 200ng DNA template, 0.15  M dari masing-masing oligonukleotida primer, 200  M dari masing-masing dNTPs, 2mM MgCl2, 10x buffer dan 1,5 unit Taq DNA polymerase  dalam 0,6ml tabung effendorf dengan total volume 50  L Kontrol negatif (tanpa DNA template) selalu disertakan dalam semua reaksi melakukan siklus PCR dengan temperatur: Denaturasi :94oC, 15 detik Primer annealing :55oC, 30 detik Primer extension: 72oC, 1.5 menit Akhiri siklus terakhir dengan perpanjangan pada 72oC selama 5 menit. Kemudian hentikan dengan mendinginkan pada suhu 4oC dan menambahkan 10mM EDTA (bila diperlukan).

14 Konsentrasi enzim Taq DNA polimerase, konsentrasi: unit per 5  L reaksi. Perlu optimisasi. Konsentrasi enzim terlalu tinggi  background non-spesifik, terlalu rendah  tidak cukup produk. Konsentrasi dNTPs Konsentrasi masing-masing dNTPs: 200  M  hasil yang baik. Pengurangan konsentrasi dNTPs dapat mengurangi mispriming pada tempat-tempat bukan target, dan mengurangi kemungkinan perluasan kesalahan penggabungan nukleotida. Konsentrasi Magnesium Sangat penting untuk dioptimumkan konsentrasinya. Mg mempengaruhi: penguatan primer (primer annealing), suhu peruraian pada template, spesifikasi produk, formasi primer-dimer, dan aktifitas serta fidelitas enzim. Masing-masing reaksi PCR diperlukan mM melebihi konsentrasi dNTP. EDTA dalam stok primer dapat mengganggu konsentrasi optimum mg.

15 Primer Umumnya antara  M (+12pM lebih baik). Terlalu tinggi konsentrasi primer: terjadi kesalahan priming (mispriming) dan penumpukan hasil yg tidak spesifik serta menyebabkan munculnya primer-dimer (independent template),  produk yg diinginkan menjadi rendah. Usahakan G-C content sekitar 50-60%, melting temperatur antara 55-80oC. Primer annealing: tergantung pada komposisi dasar, panjang dan konsentrasi primer, normalnya 5oC dibawah melting temperaturnya (hasil terbaik biasanya antara 55-75oC). Peningkatan suhu annealing dapat menyedikirtkan kesalahan pemanjangan nukleotoda. Primer extension, tergantung pd panjang dan konsentrasi target sekuen serta temperatur; optimumnya 72oC. DNA template 200ng DNA template, terlalu tinggi  non-spesifik produk. Waktu dan suhu denaturasi. Denaturasi DNA template yg tidak komplit  kegagalan PCR. Umumnya 94oC selama 30detik atau 97oC selama 15 detik cukup bagus. GC content tinggi, perlu suhu denaturasi sedikit lebih tinggi. Jumlah siklus: tergantung konsentrasi permulaan DNA target bila parameter yg lain baik. Terlalu banyak siklus  non-spesifik background; terlalu sedikit  produk sedikit. Antara umumnya memberikan hasil yg baik.


Download ppt "MARKA GEN DALAM SELEKSI TANAMAN Penggunaan Marka Gen Penggunaan Marka Gen Sifat yang memiliki nilai ekonomi tinggi umumnya bersifat kuantitatif dan dikendalikan."

Presentasi serupa


Iklan oleh Google