Presentasi sedang didownload. Silahkan tunggu

Presentasi sedang didownload. Silahkan tunggu

Sofi Siti Shofiyah 10506063 Pembimbing: Achmad S. Noer, Ph.D Seminar Tugas Akhir Heteroplasmi pada Gen 12S rRNA mtDNA Penderita Diabetes Mellitus Tipe.

Presentasi serupa


Presentasi berjudul: "Sofi Siti Shofiyah 10506063 Pembimbing: Achmad S. Noer, Ph.D Seminar Tugas Akhir Heteroplasmi pada Gen 12S rRNA mtDNA Penderita Diabetes Mellitus Tipe."— Transcript presentasi:

1 Sofi Siti Shofiyah Pembimbing: Achmad S. Noer, Ph.D Seminar Tugas Akhir Heteroplasmi pada Gen 12S rRNA mtDNA Penderita Diabetes Mellitus Tipe 2

2  Pendahuluan  Metodologi Penelitian  Hasil Penelitian  Pembahasan  Kesimpulan 27 Mei Seminar Tugas Akhir / 24

3 Pendahuluan

4 427 Mei 2010 Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan  Laju Mutasi mtDNA 10 x lebih cepat dibandingkan DNA inti  mitochondrial disease  Fokus penelitian merupakan gen 12S rRNA Seminar Tugas Akhir

5  Diabetes mellitus adalah penyakit yang ditandai dengan peningkatan kadar gula darah yang terus menerus.  Penderita diabetes di Indonesia mencapai angka 8,4 juta di tahun 2004 dan akan meningkat pada 2030 menjadi sebanyak 21,3 juta penderita (WHO,2004) 27 Mei /24 Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan Seminar Tugas Akhir Jenis Diabetes Mellitus Tipe I Insulin-dependent diabetes Kerusakan sel β-pankreas Tipe II Non-insulin-dependent diabetes Maternally Inherited Diabetes (Mutasi A3243G)

6 Heteroplasmi adalah campuran antara mtDNA termutasi dan normal pada satu sel 27 Mei 20106/24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

7 27 Mei 2010Seminar Tugas Akhir7/24 Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

8  Sampel urin penderita diabetes merupakan sampel yang tidak positif PASA (PCR Alelle Specific Alignment) A3243 G  Penelitian sebelumnya (Maksum, 2009) menduga adanya heteroplasmi pada sampel di daerah gen 12s rRNA 27 Mei 20108/24Seminar Tugas Akhir T1420G T1349G mengidentifikasi mutasi pada daerah 12s rRNA melalui dua metode amplifikasi (PCR dan kloning gen) dan membandingkannya. Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

9 27 Mei 2010Seminar Tugas Akhir9 Metodologi Penelitian

10 10/24 Hasil Lisis sampel Penderita DM Hasil PCR Amplifikasi dengan PCR Pita fragmen DNA Elektroforesis Koloni Bakteri Elektroforegram Data Mutasi DNA Analisis in silico Screening dan Isolasi Plamid Plasmid tersisipi fragmen Elektroforegram Sequencing Direct SequencingKloning gen Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

11 PrimerUrutan 5’  3’PosisiUkuran Afor (PCR)CCTCCCACTCCCATACTACT AA nukleotida Arev (PCR)GGGGTAAGATTTGCCGAGT nukelotida 2f (Seqeuencing)GAACACTACGAGCCACAGC nukelotida 27 Mei / Afor ( ) A rev ( ) Fragmen A (2034 pb) 94 o C 50 o C 72 o C 4oC4oC 5:001:00 4:00 ∞ Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

12 27 Mei /24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

13 27 Mei 2010Seminar Tugas Akhir13 Hasil Penelitian & Pembahasan

14 27 Mei /24 Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan Seminar Tugas Akhir Marker Sampel (-)

15 27 Mei /24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

16 27 Mei /24 Marker Ukuran tidak dapat ditentukan dengan jelas Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

17 27 Mei /24 Marker kb DNA ladder pb pb pb 500 pb 75 kb Sampel berukuran 5 kb Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

18 27 Mei /24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

19 27 Mei /24 Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan Penelitian Sebelumnya – Perlakuan 1 (PCR) – Perlakuan 2 (Kloning gen) (Maksum, 2009) Seminar Tugas Akhir Perlakuan 1 Perlakuan 2 Maksum, 2009 Tidak adanya mutasi pada perlakukan 1 dan 2 pada posisi 1349 dan 1420 dibandingkan dengan penelitian sebelumnya

20  Ditemukan mutasi yang ada pada setiap sampel, yaitu A1438G  Terdapat mutasi lain pada sampel hasil kloning 7, yaitu G1485A 27 Mei /24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

21  Mutasi A1438G (Ada pada setiap sampel) dilaporkan di database Mitomap sebagai mutasi yang berkaitan dengan diabetes mellitus (Tawata, 1998)  Mutasi G1485A belum dilaporkan ke Mitomap 27 Mei /24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan SindromLocusPenyakitAlelRNA Ho � � He � � Status Diabetes Mellitus MTRNR1DMC1310T12S+-Prov Diabetes Mellitus MTRNR1DMA1438G12S+-Prov Diabetes Mellitus MTTL1DM/DMDFA3243GtRNA Leu -+Cfrm

22  Sampel merupakan penderita diabetes mellitus tanpa penyakit neuropatik yang menyertai sehingga mutasi yang diperoleh diperkirakan berkaitan dengan penyakit diabetes mellitus. 27 Mei /24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan MutasiPenelitian Sebelumnya Perlakuan 1 (PCR) Perlakuan 2 (Kloning) T1349G √ -- T1420G √ -- A1438G √√√ G1485A- -√

23  Sampel bersifat heteroplasmi karena memiliki campuran mtDNA termutasi yang berbeda antara perlakuan 1, perlakuan 2, dan penelitian sebelumnya  Terdapat mutasi A1438G pada sampel dengan perlakuan PCR dan kloning yang dilaporkan berkaitan dengan diabetes mellitus  Terdapat mutasi yang belum dilaporkan, G1485A, pada sampel dengan perlakuan 2 (kloning) 27 Mei 2010Seminar Tugas Akhir23/24 Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

24 TERIMA KASIH 27 Mei /24Seminar Tugas Akhir


Download ppt "Sofi Siti Shofiyah 10506063 Pembimbing: Achmad S. Noer, Ph.D Seminar Tugas Akhir Heteroplasmi pada Gen 12S rRNA mtDNA Penderita Diabetes Mellitus Tipe."

Presentasi serupa


Iklan oleh Google